Provided are methods for generating 2D and 3D differentiated airway
organoids, 2D and 3D differentiated airway organoids which are generated
by the methods and uses for the 2D and 3D differentiated airway
organoids.
| Inventors: |
Zhou; Jie; (Hong Kong, CN)
; Yuen; Kwok Yung; (Hong Kong, CN)
; Li; Cun; (Hong Kong, CN)
; Chiu; Man Chun; (Hong Kong, CN)
; Clevers; Johannes Carolus; (Amsterdam, NL)
|
| Applicant: | | Name | City | State | Country | Type |
THE UNIVERSITY OF HONG KONG
Koninklijke Nederlandse Akademie Van Wetenschappen |
Hong Kong
Amsterdam | |
CN
NL | | |
|---|
| Family ID:
|
68696825
|
| Appl. No.:
|
17/059965
|
| Filed:
|
May 31, 2019 |
| PCT Filed:
|
May 31, 2019 |
| PCT NO:
|
PCT/CN2019/089613 |
| 371 Date:
|
November 30, 2020 |
Related U.S. Patent Documents
| | | | |
|---|
|
| Application Number | Filing Date | Patent Number |
|---|
| | 62679788 | Jun 2, 2018 | |
|
|
| Current U.S. Class: |
1/1 |
| Current CPC Class: |
C12N 2501/30 20130101; G01N 2333/11 20130101; C12N 7/00 20130101; C12N 2500/84 20130101; C12N 2501/999 20130101; C12N 2760/16011 20130101; C12N 5/0062 20130101; C12N 2500/25 20130101; C12N 2501/11 20130101; G01N 33/5082 20130101; C12N 2513/00 20130101 |
| International Class: |
C12N 5/00 20060101 C12N005/00; C12N 7/00 20060101 C12N007/00; G01N 33/50 20060101 G01N033/50 |
Claims
1. A method of generating a proximal differentiated airway organoid
(PD-organoid) comprising culturing an airway organoid (AO-organoid) in a
proximal differentiation medium for a period of time sufficient to
generate a PD-organoid comprising a cell population consisting of at
least 25%, at least 30%, at least 35% or at least 40% ciliated cells,
wherein the ciliated cells are characterised by FOXJ1 and SNTN
expression.
2. The method of claim 1, wherein the proximal differentiation medium is
supplemented with a notch inhibitor, optionally selected from the group
consisting of a gamma-secretase inhibitor, such as DAPT or dibenzazepine
(DBZ) or benzodiazepine (BZ) or LY-411575.
3. (canceled)
4. The method of claim 2, wherein the notch inhibitor is DAPT, preferably
at a concentration of between 5 and 30 .mu.M, preferably between 10 and
20 .mu.M, or more preferably about 10 .mu.M.
5. The method of claim 1, wherein the proximal differentiation medium
comprises one or more components as set out in Table 2, optionally at the
concentrations shown in Table 2; and/or wherein the proximal
differentiation medium is PneumaCult-ALI medium (StemCell Technologies)
supplemented with notch inhibitor.
6. The method of claim 5, wherein the proximal differentiation medium
comprises at least EGF, insulin, transferrin, hydrocortisone,
triiodothyronine and epinephrine.
7. The method of claim 6, wherein the proximal differentiation medium
further comprises bovine serum albumin and/or bovine pituitary extract.
8. (canceled)
9. The method of any claim 1, wherein the method further comprises one or
more of the following steps prior to culturing the AO-organoid in a
proximal differentiation medium: a. obtaining a lung tissue sample from a
subject; b. obtaining dissociated cells from a lung tissue sample; and c.
culturing lung cells in an AO-organoid formation phase for a period of
time sufficient to generate an AO-organoid.
10. The method of claim 9, wherein the AO-organoid formation phase
comprises culturing cells in an AO-organoid medium comprising one or more
components as set out in Table 1, optionally at the concentrations shown
in Table 1.
11. The method of claim 10, wherein the AO-organoid medium comprises at
least R-spondin, a BMP inhibitor, a TGF-beta inhibitor, FGF and heregulin
beta-1.
12. The method of claim 11, wherein the step of culturing the lung cells
and/or AO-organoid comprises culturing the cells in contact with an
exogenous extracellular matrix (such as a basement membrane extract or
Matrigel.TM.).
13. The method of claim 1, wherein: (a) the AO-organoid is a 3D organoid;
(b) the PD-organoid is a 3D organoid; and/or (c) the PD-organoid is a 2D
organoid.
14. (canceled)
15. (canceled)
16. The method of claim 13, wherein the step of culturing in a proximal
differentiation medium comprises culturing in a transwell culture system
comprising an apical and basal chamber.
17. A method of generating a 3D PD-organoid in accordance with claim 13
comprising the steps of: a. culturing lung cells from a subject in an
AO-organoid formation phase in an AO-organoid medium in contact with an
extracellular matrix for a period of time sufficient to generate a 3D
AO-organoid, for example for at least 2 days; and b. changing the AO
medium to a proximal differentiation medium supplemented with a notch
inhibitor and culturing the 3D AO-organoid in the proximal
differentiation medium supplemented with a notch inhibitor for a period
of time sufficient to generate a PD-organoid, for example for at least 5
days, at least 10 days, at least 14 days or at least 16 days.
18. A method of generating a 2D PD-organoid in accordance with claim 13
comprising the steps of: a. culturing lung cells from a subject in an
AO-organoid formation phase in an AO-organoid medium in contact with an
extracellular matrix for a period of time sufficient to generate a 3D
AO-organoid, for example for at least 2 days; b. dissociating the 3D
AO-organoids into single cell suspension; c. seeding the dissociated
cells in the apical chamber of a transwell culture system; d. optionally
culturing the seeded cells in AO medium for at least 1 day, for example,
until the cells reach at least 90% confluence; and e. culturing the
seeded cells in proximal differentiation medium supplemented with a notch
inhibitor for a period of time sufficient to generate a 2D PD-organoid,
for example for at least 5 days, at least 10 days, at least 14 days or at
least 16 days.
19. The method of claim 16, wherein: (a) the culture medium is added to
both the apical and basal chambers of the transwell culture system; (b)
wherein the culture medium is refreshed every other day; and/or (c) the
organoid or cells are human organoids or human cells.
20. (canceled)
21. (canceled)
22. A PD-organoid obtained by a method of claim 1, wherein the
PD-organoid consists of a cell population comprising at least 25%, at
least 30%, at least 35% or at least 40% ciliated cells, wherein the
ciliated cells are characterised by FOXJ1 and SNTN expression.
23. The PD-organoid of claim 22, wherein: (a) the PD-organoid has at
least 2-fold or at least 3-fold increase in the proportion of ciliated
cells when compared to the AO-organoid from which it is derived; (b) the
PD is further characterised by serine protease expression, for example,
expression of one or more or all of TMPRSS2, TMPRSS4, TMPRSS11D (HAT) and
Matriptase; (c) expression of HAT is at least 1 log.sub.10 fold increased
relative to its expression in AO-organoids; and/or (d) the ciliated cells
make up at least 10-40% of the cells in the organoid by day 12, by day
14, or by day 16 after culturing in the proximal differentiation medium.
24. (canceled)
25. (canceled)
26. (canceled)
27. The PD-organoid of claim 22, further comprising one or more or all of
the following cell types: a. basal cells, characterised by P63 and CK5
expression; b. goblet cells, characterised by MUC5AC expression; and c.
club cells characterised by lack of CC10 and SCGB3A2 expression.
28. The PD-organoid of claim 22, wherein gene expression is assessed
using quantitative PCR of mRNA transcripts normalised with GAPDH; and/or
(b) the PD-organoid further comprises an influenza virus.
29. (canceled)
30. (canceled)
31. A method for contracting an influenza virus in a PD-organoid, wherein
the method comprises: a. generating a PD-organoid in accordance with
claim 1; and b. infecting the PD-organoid with an influenza virus.
32. The method of claim 31, wherein: (a) the infecting step comprises
inoculating with the influenza virus at a multiplicity of infection of at
least 0.001, at least 0.01 or between 0.001 and 0.01; (b) the infecting
step further comprising incubating for at least 30 minutes, at least 60
minutes, at least 90 minutes or at least 120 minutes; (c) the contacting
step is at the apical surface of the PD-organoid; (c) the PD-organoid is
a 2D organoid and contacting step involves adding the influenza virus to
the apical chamber of the transwell culture system or (d) the PD-organoid
is a 3D organoid and the method further comprises a step of exposing the
apical surface of the 3D organoid, for example by mechanical shearing,
prior to contacting the PD-organoid with an influenza virus.
33. (canceled)
34. The method of claim 32, wherein the incubating step is performed at
about 37.degree. C.; or the method further comprises re-contacting the 3D
organoid with an extracellular matrix and culturing the PD-organoid in a
proximal differentiation medium, after infecting, and optionally
incubating, the PD-organoid with the influenza virus.
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. A method for predicting infectivity of a test influenza virus to
humans, wherein the method comprises: a. generating a human PD-organoid
in accordance with claim 1; b. contacting the human PD-organoid with the
test influenza virus; c. testing the viral titre after a time period
sufficient to allow viral propagation; d. optionally comparing the viral
titre to a control influenza virus.
40. The method of claim 39, wherein: (a) testing the viral titre involves
detecting a change in viral titre; (b) the control influenza virus is a
known poorly-infective-to-humans influenza virus, optionally wherein the
change in viral titre of the test influenza virus is greater than the
change in viral titre of the known poorly-infective-to-humans influenza
virus, for example wherein the viral titre is at least 10-fold, at least
50-fold, at least 100-fold, at least 1,000 fold or at least 10,000 fold
greater than the viral titre of the known poorly-infective-to-humans
influenza virus; or (c) the control influenza virus is a known
infective-to-humans influenza virus, optionally wherein the change viral
titre of the test influenza virus is about the same or greater than the
viral titre of the known infective-to-humans influenza virus, for
example, at least 75%, at least 80%, at least 90%, at least 100%, at
least 150%, at least 2-fold, at least 5-fold or at least 10-fold relative
to the viral titre of the known infective-to-humans influenza virus.
41. The method of claim 40, wherein an increase in viral titre is
indicative of likely infectivity of the influenza virus to humans and/or
wherein a greater increase over a shorter time period is correlated with
a higher degree of infectivity and optionally, wherein the increase in
viral titre is at least 1 login units, at least 2 log.sub.10 units, or at
least 3 log.sub.10 units within 24 hours.
42. (canceled)
43. (canceled)
44. The method of claim 41, wherein the known poorly-infective influenza
virus is selected from H7N2, H9N2 and H9N9.
45. (canceled)
46. (canceled)
47. The method or PD-organoid of claim 1, wherein the influenza virus is:
a. an influenza A virus; b. a human, avian or swine influenza virus;
and/or c. an emerging influenza virus.
Description
FIELD OF THE INVENTION
[0001] The invention is generally directed to airway organoids,
particularly differentiated airway organoids, methods of making and
using, particularly for influenza virus research.
BACKGROUND OF THE INVENTION
[0002] Influenza A viruses (IAVs) can infect a diversity of avian and
mammalian species including humans, and have the remarkable capacity to
evolve and adapt to new hosts (1). The segmented RNA genomes of IAVs and
the low fidelity of RNA polymerase allow for antigenic shift and drift,
which drive this evolution. Thus, novel viruses from birds and pigs can
cross the species barrier and infect humans, leading to sporadic
infections, epidemics and even pandemics (Klenk, Cell Host Microbe
15(6):653-654 (2014); To, et al., Lancet 381(9881):1916-1925 (2013)).
Despite the tremendous progress made in virology and epidemiology, it
remains unpredictable which subtype or strain of IAV will cause the next
outbreak. A novel reassortant H7N9 influenza virus from poultry has led
to recurrent outbreaks of human infections in China since 2013 (To, et
al., Lancet 381(9881):1916-1925 (2013)), Chen, et al., Lancet
381(9881):1916-1925 (2013)). According to a World Organization report
more than 1500 laboratory-confirmed cases of H7N9 human infections were
reported by October 2017, with a case-fatality rate higher than 35%. In
2009, the first influenza pandemic of the 21.sup.st century was caused by
a novel pandemic H1N1 (H1N1pdm), which originated via multiple
reassortment of "classical" swine H1N1 virus with human H3N2 virus, avian
virus and avian-like swine virus (AVIT, et al., N Engl J Med
360(25):2605-2615 (2009)). While swine viruses only sporadically infect
humans, this novel strain of swine-derived H1N1pdm virus can establish
sustained human-to-human transmission and has been circulating globally
as a seasonal virus strain since then. Proteolytic cleavage of viral
glycoprotein hemagglutinin (HA) is essential for IAV to acquire
infectivity since only the cleaved HA molecule mediates the membrane
fusion between virus and host cell, a process required for the initiation
of infection. HA proteins of low pathogenic avian IAVs and human IAVs
carry a single basic amino acid arginine at the cleavage site (Bottcher
E, et al., J Virol 80(19):9896-9898 (2006); Bosch, et al., Virology
113(2):725-735 (1981)), recognized by trypsin-like serine proteases.
Productive infection of these viruses in human airway thus requires
serine proteases like TMPRSS2, TMPRSS4, HAT etc.
(Bottcher-Friebertshauser et al., Pathog Dis 69(2):87-100 (2013).
However, HA proteins of high pathogenic avian viruses, such as H5N1,
contain a polybasic cleavage site that is activated by ubiquitously
expressed proteases.
[0003] Current in vitro models for studying influenza infection in human
respiratory tract involve short-term cultures of human lung explant and
primary airway epithelial cells. Human lung explants are not readily
available on a routine basis. In addition, rapid deterioration of primary
tissue in infection experiments is a major problem. Under air-liquid
interface conditions, basal cells isolated from human airway can polarize
and undergo mucociliary differentiation. Yet, this capacity is lost
within 2-3 passages (Butler, et al., Am J Respir Crit Care Med
194(2):156-168 (2016)). Collectively, these primary tissues and cells
barely constitute a convenient, reproducible model to study human
respiratory pathogens. Although various cell lines, e.g. A549 and MDCK,
have commonly been used to propagate influenza viruses and to study
virology, they poorly recapitulate the histology of human airway
epithelium. In addition, due to the low serine protease activity, most
cell lines do not support the growth of the influenza viruses with
monobasic HA cleavage site unless the culture medium is supplemented the
exogenous serine protease, trypsin treated with N-tosyl-L-phenylalanine
chloromethyl ketone (TPCK). Thus, a biologically-relevant, reproducible,
and readily-available in vitro model remains desperately needed for
studying biology and pathology of the human respiratory tract.
[0004] Recent advances in stem cell biology have allowed the in vitro
growth of 3 dimensional (3D) organoids that recapitulate essential
attributes of their counterpart-organs in vivo. These organoids can be
grown from pluripotent stem cells (PSC) or tissue-resident adult stem
cells (ASC) (Clevers, et al., Cell 165(7):1586-1597 (2016)). ASC-derived
organoids consist exclusively of epithelial cells and can be generated
from a variety of human organs, the first being the human gut (Sato, et
al., Gastroenterology 141(5):1762-1772 (2011)). These human intestinal
organoids represent the first model for in vitro propagation of Norovirus
and has allowed the study of other viruses (Ettayebi, et al., Science,
353:1387-1393 (2016); Zhou, et al., Sci. Adv. 3(11);eaao4966 (2017)).
ASC-derived lung organoids have also been described (WO2016/083613).
[0005] Of note, protocols have also been established to generate lung
organoids from human PSCs, embryonic lung (Chen, et al., Nat Cell Biol
19(5):542-549, (2017); Nikolic, et al., Elife 6: e26575 (2017)),
embryonic stem cells and induced pluripotent stem cells (iPSC) (Konishi,
et al., Stem Cell Reports, 6(1):18-25 (2016)).
[0006] However, there is still a need for improved methods of generating
in vitro cellular systems that recapitulate the histology and
functionality of mature (differentiated) human airway epithelium, for
example, for use in modelling infection, particularly influenza
infection. There is, in particular, a need for improved methods of
differentiating ASC-derived lung organoids. Such methods would be
advantageous because they do not rely on induced pluripotent stem cells,
embryonic stem cells or embryonic lung. Therefore, it is the object of
the present invention to provide a method of generating an in vitro
cellular system that recapitulates the histology and functionality of
mature human airway epithelium for use in modelling diseases, for
example, influenza infection.
[0007] It is another object of the present invention to provide a method
of differentiating lung organoids, preferably wherein said method does
not rely on induced pluripotent stem cells, embryonic stem cells or
embryonic lung.
[0008] It is another object of the present invention to provide improved
in vitro differentiated lung organoids that recapitulate the histology of
human airway epithelium.
[0009] It is yet another object of the present invention to provide
methods for studying the biology and pathology of the human airway
epithelium.
SUMMARY OF THE INVENTION
[0010] Methods for obtaining a population of differentiated airway
epithelial cells, differentiated airway epithelial cells generated by the
disclosed methods and uses for the differentiated airway epithelial cells
are provided.
[0011] In particular, methods for generating two-dimensional (2D) and
three-dimensional (3D) differentiated airway organoids, differentiated 2D
and 3D airway organoids generated by the disclosed methods, and uses for
the 2D and 3D airway organoids are provided.
[0012] The methods of generating differentiated airway organoids include
obtaining a lung tissue sample from a subject, obtaining dissociated
cells from the lung sample, culturing the dissociated cells in a two
phase process (a) organoid formation phase and (b) organoid maturation
phase. The organoid formation phase involves culturing the dissociated
cells in an airway organoid (AO) medium for a period of time sufficient
to form an airway organoid. The organoid maturation phase involves
culturing the airway organoids from the formation phase in proximal
differentiation (PD) medium, for a period of time effective to improve
morphology and differentiation of cells in the organoid. Criteria
indicating an improvement in morphology and differentiation include for
example, an increase in the percentage of ciliated cell number following
culture in PD medium. 2D and 3D airway organoids obtained by a
combination of AO and PD culture are referred to herein as proximal
differentiated airway organoids (or "PD-organoids"). 2D differentiated
organoids are obtained by a method that comprises dissociating the 3D
airway organoids into a single cell suspension, and seeding the cells in
transwell inserts, before culturing the cells in PD medium, preferably
for a period of time effective for formation of an intact epithelial
barrier. This can be measured by trans-epithelial electronic resistance
and a dextran penetration assay.
[0013] The disclosed PD-organoids include a combination of basal cells,
goblet cells, club cells and enriched ciliated cells, and accordingly,
express one or more markers selected from the group consisting of
ciliated cell markers (FOXJ1 and SNTN), basal cell markers (P63, CK5);
goblet cell marker (MUC5AC) and increased serine proteases including
TMPRSS2, TMPRSS4, TMPRSS11D (HAT) and Matriptase. In one preferred
embodiment, PD organoids are disclosed which include readily discernible
ciliated cells at a percentage greater than 10%, preferably, greater than
20%. For example, ciliated cells can make up at least 40% of the cells in
the organoid, at day 14, preferably, day 16 post PD cell culture. 2D PD
airway monolayers are provided, with an intact epithelial barrier to
simulate the real human airway epithelium and model the natural mode of
pathogen exposure to the human airway.
[0014] Also disclosed are methods to evaluate the biology and pathology of
human airway epithelium for example, to assess the infectivity of an
emerging influenza virus, such as H7N9.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGS. 1A-1C show viral loads in airway organoids inoculated with
H1N1pdm, H5N1 and H7N9/Ah. The airway organoids were inoculated with
H1N1pdm, H5N1 and H7N9/Ah at an MOI of 0.01. The infected organoids (cell
lysate) and supernatants were harvested at the indicated hours to detect
the viral loads. Supernatant samples were used for viral titration. Data
showing mean.+-.SD of triplicated samples.
[0016] FIG. 2 shows the diameters of individual organoids. The images of
organoids cultured in PD medium and AO medium are used to measure the
diameters of individual organoids (n=300) using ImageJ. Student's T test
was used for data analysis. ***, P<0.005.
[0017] FIGS. 3A-D show characterization of the differentiation status of
airway organoids. (FIGS. 3A and 3B). Fold changes in expression levels of
cell type markers (FIG. 3A) and serine proteases (FIG. 3B) in the
organoids cultured in PD medium versus those in AO medium at the
indicated day. Data show mean and SD of two lines of organoids. FIG. 3C
shows the percentages of individual cell types in the organoids cultured
in PD medium and AO medium. The representative histograms of one organoid
line are shown. FIG. 3D shows fold changes in positive cell percentages
in the organoids cultured in PD medium versus those in AO medium.
[0018] FIGS. 4A-C. Influenza virus infection in the 3D PD airway
organoids. The 3D PD airway organoids were inoculated with H7N9/Ah and
H7N2 virus at an MOI of 0.01. The infected organoids (cell lysate) and
supernatants were harvested at the indicated hours to detect the viral
loads (FIGS. 4A and 4B). Supernatant samples were used for viral
titration (FIG. 4C). Data showing mean.+-.SD of triplicated samples in
one representative experiment repeated 3 times.
[0019] FIGS. 5A-B show formation of epithelial barrier in 2D monolayers of
differentiated airway organoids in transwell culture. The 3D airway
organoids were dissociated into single cells, seeded in transwell inserts
and cultured in AO medium. At day 2, AO medium was replaced with PD
medium. (A) Trans-epithelial electronic resistance (TEER) was measured at
the indicated day post seeding. Data show the cell-specific TEER
(mean.+-.SD) of 2D monolayers in 10 inserts. (B) At day 10 after
transwell culture, Fluorescein isothiocyanate-dextran (MW10k) was added
in the medium of upper chamber and incubated for 4 hours. The medium in
the upper and bottom chamber were collected and applied to fluorescence
assay. Dextran blockage index refers to the fluorescence intensity of the
medium in the upper chamber versus that in the bottom chamber. Data
represent mean and SD of 10 inserts seeded with 2D airway organoids and
those in two blank inserts. FIGS. 5C and 5D show replication capacity of
influenza viruses in established 2D differentiated airway organoids. 2D
PD airway organoids were inoculated in duplicate with H7N9/Ah, H7N2 as
well as H1N1pdm, H1N1sw at an MOI of 0.001. The cell-free media were
harvested from apical and basolateral chambers at the indicated hours
post infection (hpi) for viral titration.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0020] A "base media," as used herein, refers to a basal salt nutrient or
an aqueous solution of salts and other elements that provide cells with
water and certain bulk inorganic ions essential for normal cell
metabolism and maintains intra-cellular and/or extra-cellular osmotic
balance.
[0021] An ErbB3/4 ligand is herein defined as a ligand that is capable of
binding to ErbB3 and/or ErB4.
[0022] The term "Induced pluripotent stem cell" (iPSC), as used herein, is
a type of pluripotent stem cell artificially derived from a
non-pluripotent cell.
[0023] "Media" or "culture media" as used herein refers to an aqueous
based solution that is provided for the growth, viability, or storage of
cells used in carrying out the present invention. A media or culture
media may be natural or artificial. A media or culture media may include
a base media and may be supplemented with nutrients (e.g., salts, amino
acids, vitamins, trace elements, antioxidants) to promote the desired
cellular activity, such as cell viability, growth, proliferation, and/or
differentiation of the cells cultured in the media.
[0024] "Organoid" as used herein refers to an artificial, in vitro
construct derived from adult stem cells created to mimic or resemble the
functionality and/or histological structure of an organ or portion
thereof.
[0025] The term "pluripotency" (or pluripotent), as used herein refers to
a stem cell that has the potential to differentiate into any of the three
germ layers: endoderm (for example, interior stomach lining,
gastrointestinal tract, the lungs), mesoderm (for example, muscle, bone,
blood, urogenital), or ectoderm (for example, epidermal tissues and
nervous system).
[0026] Recitation of ranges of values herein are merely intended to serve
as a shorthand method of referring individually to each separate value
falling within the range, unless otherwise indicated herein, and each
separate value is incorporated into the specification as if it were
individually recited herein.
[0027] Use of the term "about" is intended to describe values either above
or below the stated value in a range of approx. +/-10%; in other
embodiments the values may range in value either above or below the
stated value in a range of approx. +/-5%; in other embodiments the values
may range in value either above or below the stated value in a range of
approx. +/-2%; in other embodiments the values may range in value either
above or below the stated value in a range of approx. +/-1%. The
preceding ranges are intended to be made clear by context, and no further
limitation is implied. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise clearly
contradicted by context. The use of any and all examples, or exemplary
language (e.g., "such as") provided herein, is intended merely to better
illuminate the invention and does not pose a limitation on the scope of
the invention unless otherwise claimed. No language in the specification
should be construed as indicating any non-claimed element as essential to
the practice of the invention.
II. Compositions
[0028] 2D and 3D airway organoids are provided, differentiated by culture
of cells obtained from lung tissue, in AO culture medium followed by
culture in PD cell culture medium. An organoid is a cellular cluster
derived from stem cells or primary tissues and exhibits endogenous organ
architecture. See, e.g., Cantrell and Kuo, Genome Medicine 7:32-34
(2015). Organoids differ from naturally occurring in vivo tissues and
from ex vivo tissue explants because they are derived from expansion of
epithelial tissue cells only.
[0029] The disclosed 3D and 2D differentiated airway organoids support
active replication of human infective H7N9/Ah and H1N1pdm. In contrast,
the H7N2 virus, which has been temporally and spatially co-circulating
with H7N9 viruses in domestic poultry and contains the similar internal
genes as H7N9 viruses, replicated much less efficiently in both models.
Similarly, the swine H1N1 isolate showed a lower growth capacity than its
counterpart of human-adapted H1N1pdm (FIG. 5B). Thus, these PD airway
organoids discriminate human infective viruses from poorly infective
viruses.
[0030] In particularly preferred embodiments cells the disclosed 2D and 3D
organoids do not recombinantly express of Oct3/4, Sox2, Klf4, c-Myc,
L-MYC, LIN28, shRNA for TP53 or combinations thereof, i.e., the 2D and 3D
organoids do not include cells genetically engineered to Oct3/4, Sox2,
Klf4, c-Myc, L-MYC, LIN28, shRNA for TP53 or combinations thereof.
[0031] A. 3D PD-Airway Organoids
[0032] In vitro 3D airway organoids are disclosed. The airway organoids
are 3D cysts lined by polarized epithelium. The disclosed airway
organoids include a combination of basal cells, ciliated cells, goblet
cells, and club cells, and accordingly, express one or more markers
selected from the group consisting of ciliated cell markers (FOXJ1 and
SNTN), basal cell markers (P63, CK5); goblet cell marker (MUC5AC) and
serine proteases including TMPRSS2, TMPRSS4, TMPRSS11D (HAT) and
Matriptase. Ciliary beating plays essential roles in human airway biology
and pathology, and 50%-80% of airway epithelial cells are ciliated
(Yaghi, et al., Cells, 5(4): pii:E402016)). The data in this application
demonstrates that the ability to obtain airway organoids with a ciliated
cell population that approaches physiological levels (i.e., more than 40%
of the total population of organoid cells), depends on the cell culture
medium selection (i.e. the factors used to supplement basal medium) as
well as the cell culture protocol used to culture cells obtained from
lung tissue i.e., timing of when cells are exposed cells to the
combination of factors used to supplement basal medium). In a
particularly preferred embodiment, the 3D PD-airway organoids contain no
type I and type II alveolar epithelial cells in contrast to whole lung
tissue, and the cilia on the PD-organoids beat synchronously. The
disclosed organoids, generated from in vitro culture using a combination
of AO and PD culture medium (PD-organoids) show improved expression of
these markers, when compared to airway organoids generated from in vitro
culture in AO culture medium alone (AO-organoids) for the same length of
time. Criteria indicating an improvement in morphology and
differentiation include for example, an increase in the percentage of
ciliated cells following culture in PD medium. When compared to 3D
AO-organoids, PD-organoids contain an increased level of ciliated and
goblet cells, for example, a 2 fold, to 100 fold increase. In one
preferred embodiment, PD organoids are disclosed which include ciliated
cells with a near-physiological abundance at a percentage greater than
10%, preferably, greater than 20%. For example, ciliated cells can make
up at least 40% of the cells in the organoid, at day 16 post PD cell
culture. Thus, the PD organoids contain about 40% ciliated cells,
preferably, between 40 and 50% ciliated cells at day 16 post PD medium
cell culture. Meanwhile 3D PD-organoids contain a decreased level of club
cells when compared to 3D AO-organoids.
[0033] PD-organoids show reduced expression of Club cell markers (CC10,
SCGB3A2) compared to AO-organoids.
[0034] B. 2D Differentiated Airway Organoids
[0035] 2D PD airway monolayers are provided, with an intact epithelial
barrier to allow exclusive apical exposure. The presence of an intact
epithelial barrier is determined for example using Transepithelial
electrical resistance (TEER). Stabilization of TEER measurement shows
formation of an intact barrier as shown for Example in FIG. 5A (shows
stabilization of TEER at day 6). The electrical resistance of a cellular
monolayer, measured in ohms, is a quantitative measure of the barrier
integrity. Other methods of measuring monolayer integrity are known in
the art. Reviewed in Elbrecht, et al., J. Rare Disease and Treat.
1(3):46-52 (2016); benson, et al., Fluids Barriers CAN, 10:5 (2013).
[0036] A limitation of 3D organoids for studying microbial infections is
the inaccessibility of apical surface to pathogens since most organoids
are orientated inwards, while receptors for most respiratory viruses are
distributed in the apical surface. For virus inoculation, organoids have
to be sheared to enable sufficient apical exposure to the virus inoculum
(Drumond, et al., P.N.A.S., 114(7):1672 2677 (2017)).
[0037] The disclosed 2D PD organoids include an apical side and a
basolateral side. Cells in the 2D organoid include a combination of basal
cells, ciliated cells, goblet cells, and club cells, and accordingly,
express one or more markers selected from the group consisting of
ciliated cell markers (FOXJ1 and SNTN), basal cell markers (P63, CK5);
goblet cell marker (MUCSAC) and serine proteases including TMPRSS2,
TMPRSS4, TMPRSS11D (HAT) and Matriptase. In a particularly preferred
embodiment, the 3D PD-airway organoids contain no type I and type II
alveolar epithelial cells.
III. Methods of Making Airway Organoids
[0038] The disclosed methods outline steps for culturing cells obtained
from lung tissue to generate 3D organoids.
[0039] Airway adult stem cell (ASC)-derived organoids disclosed herein,
once established, can be expanded indefinitely while displaying
remarkable phenotypic and genotype stability. They thus overcome the
reproducibility and availability limitations of the current in vitro
model systems. Several lines of airway organoids were obtained from small
pieces of normal lung tissue adjacent to the diseased tissue from
patients undergoing surgical resection for clinical conditions. These
airway organoids, 3D cysts lined by polarized epithelium, include the
four major types of airway epithelial cells, i.e. ciliated cell (ACCTUB+
or FOXJ1+), basal cell (P63+), goblet cell (MUC5AC+), and Club cell
(CC10+) (FIG. 1A). The cell culture media used to generate the airway
organoids in some preferred embodiments does not include BMP (bone
morphogenic protein) 4. In one preferred embodiment, generating a line of
3D organoids from primary lung tissues in AO culture medium disclosed
herein takes preferably between one and four weeks, more preferably,
between 2 and 3 weeks.
[0040] A. 3D PD-Airway Organoids
[0041] One embodiment provides a method of making an organoid from a
mammalian tissue in vitro comprising: (a) obtaining a lung tissue sample
from a subject, (b) isolating cells from the mammalian tissue to provide
isolated cells by subjecting the tissue sample into single cells; (c)
culturing the cells in an airway organoid (AO) culture medium for at
least one to four weeks, preferably between 2 and 3 weeks to generate 3D
airway organoids. The established 3D airway organoids can be maintained
in AO medium and passaged every two to three weeks. (d) and preparing
(adjusting) the established 3D airway organoids to an appropriate state
(e) culturing the 3D airway organoids in differentiation medium,
preferably a proximal differentiation medium (PD), for a time sufficient
to produce differentiated airway organoids. In step (d),the 3D airway
organoids are split and maintained in AO medium for at least 2 to 16
days, for example 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days,
9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or 16 days.
Steps (c) and (d) are preferably three dimensional (3D) cell culture, as
opposed to 2D cell culture. While the 2D culture usually grows cells into
a monolayer on glass or, more commonly, tissue culture polystyrene
plastic flasks, 3D cell cultures grow cells into 3D aggregates/spheroids
using a scaffold/matrix. Commonly used scaffold/matrix materials include
biologically derived scaffold systems and synthetic-based materials.
[0042] In some preferred embodiment, the method is performed with a
commercially using extracellular matrix. In some preferred embodiment,
the method is performed with a commercially available extracellular
matrix such as MATRIGEL.TM. (growth Factor Reduced Basement Membrane
Matrix). Other extracellular matrices (ECM) are known in the art for
culturing cells. A preferred ECM for use in a method of the invention
includes at least two distinct glycoproteins, such as two different types
of collagen or a collagen and laminin. In some preferred embodiment, the
method is performed with a commercially available extracellular matrix
such as MATRIGEL.TM. (growth Factor Reduced Basement Membrane Matrix),
which comprises laminin, entactin, and collagen IV. In general, an
extracellular matrix comprises laminin, entactin, and collagen. In a
preferred embodiment, the method is performed using a 3-dimensional
culture device (chamber) that mimics an in vivo environment for the
culturing of the cells, where preferably the extracellular matrix is
formed inside a plate that is capable of inducing the proliferation of
stem cells under hypoxic conditions. Such 3-dimensional devices are known
in the art. Other commercially available products include Cultrex.RTM.
basement membrane extract (BME; Trevigen), and hyaluronic acid are
commonly used biologically derived matrixes. Polyethylene glycol (PEG),
polyvinyl alcohol (PVA), polylactide-co-glycolide (PLG), and
polycaprolactone (PLA) are common materials used to form synthetic
scaffolds. Scaffold-free 3D cell spheroids can be generated in
suspensions by the forced floating method, the hanging drop method, or
agitation-based approaches. Edmondson, et al., Assay Drug. Dev. Technol.,
12(4):207-218 (2014). For example, the isolated cells are embedding in
60% MATRIGEL.TM. and seeded in a suspension culture plate prior to
culture in the (AO) medium.
[0043] In still another preferred embodiment, the AO culture medium step
does not include cells expressing Oct4 and/or are not genetically
engineered to express one or more markers of pluripotency i.e., the cells
iPSC, for example, adult cells induced to pluripotency by expression of
Oct3/4, Sox2, Klf4, c-Myc, L-MYC, LIN28, shRNA for TP53 or combinations
thereof, or embryonic stem cells, for example, H9 hESCs (Thomson et al.,
Science 282:1145-1147 (1998)), 201B7 (Takahashi et al., Cell,
131(5):861-72 (2007)), 585A1 or 604A1 hiPSCs (Okita et al., Stem Cells,
31(3):458-66 (2013)).
[0044] (i) Sources for Airway Organoids
[0045] The disclosed organoids can be cultured from a tissue sample
preferably a lung tissue sample obtained from a mammal, such as any
mammal (e.g., bovine, ovine, porcine, canine, feline, equine, primate),
preferably a human.
[0046] In a preferred embodiment, the lung tissue is not obtained from an
embryonic human lung, and is preferably obtained from non-embryonic lungs
for example, juvenile or adult lungs, preferably, adult lung.
[0047] In one embodiment, single cells are obtained from a tissue sample
using a combination of steps that result in single cells. The tissue
sample size can range in size from 0.1 cm to 10 cm, for example, between
0.5 and 5 cm, in some preferred embodiments between 0.5 and 1.0 cm in
size. Cells may be isolated by disaggregating an appropriate organ or
tissue that is to serve as the cell source using techniques known to
those skilled in the art. For example, the tissue or organ can be
disaggregated mechanically and treated with digestive enzymes and/or
chelating agents to release the cells, to form a suspension of individual
cells. Enzymatic dissociation can be accomplished by mincing the tissue
and treating the minced tissue with one or more enzymes such as trypsin,
chymotrypsin, collagenase, elastase, and/or hyaluronidase, DNase,
pronase, dispase etc.
[0048] In a preferred embodiment, single cells are obtained from the lung
tissue sample by mincing a lung tissue sample obtained from a subject,
digesting with collagenase for 1 to two hours at 37.degree. C., followed
by shearing using glass Pasteur pipette and straining over a filter, for
example, a 100 .mu.m cell strainer.
[0049] In another preferred embodiment adult stem cells are obtained from
lung tissue sample by selecting for cells expressing the Lgr5 and/or
receptor, which belong to the large G protein-coupled receptor (GPCR)
superfamily. One embodiment includes preparing a cell suspension from
lung tissue, contacting the cell suspension with cells expressing the
Lgr5 and/or receptor, isolating the Lgr5 and/or 6 binding compound, and
isolating the stem cells from the binding compound. Examples of Lgr5
and/or Lgr6 binding compounds include antibodies, such as monoclonal
antibodies, that specifically recognize and bind to the extracellular
domain of either Lgr5 or Lgr6. Using such an antibody, Lgr5 and/or
Lgr6-expressing stem cells can be isolated using methods known in the
art, for example, with the aid of magnetic beads or through
fluorescence-activated cell sorting.
[0050] In one preferred embodiment the disclosed method does not include
the step of selecting for cells expressing any markers, for example, the
Lgr5 and/or receptor, using Lgr5 and/or Lgr6 binding compounds or
biomarkers for lung disease, such as CPM (carboxypeptidase M) (Dragavic,
et al., Am. J. Respir. Crit Care Med., 152:760-764 (1995). This
embodiment contemplates a method of generating airway organoids, that
does not include enriching the population of starting cells based on
surface marker expression
[0051] Isolated cells are further cultured as discussed herein. A
preferred cell culture medium is a defined synthetic medium, buffered at
a pH of 7.4 (preferably between 7.2 and 7.6 or at least 7.2 and not
higher than 7.6) with a carbonate-based buffer, while the cells are
cultured in an atmosphere comprising between 5% and 10% CO.sub.2, or at
least 5% and not more than 10% CO.sub.2, preferably 5% CO.sub.2.
[0052] (ii) AO Culture Medium
[0053] The cells are cultured in supplemented basal cell culture media. In
some embodiments, a base media may include at least one carbohydrate as
an energy source and/or a buffering system to maintain the medium within
the physiological pH range. Examples of commercially available base media
may include, but are not limited to, phosphate buffered saline (PBS),
Dulbecco's Modified Eagle's Medium (DMEM), Minimal Essential Medium
(MEM), Basal Medium Eagle (BME), Roswell Park Memorial Institute Medium
(RPMI) 1640, MCDB 131, Click's medium, McCoy's 5 A Medium, Medium 199,
William's Medium E, insect media such as Grace's medium, Ham's Nutrient
mixture F-10 (Ham's F-10), Ham's F-12, a-Minimal Essential Medium (aMEM),
Glasgow's Minimal Essential Medium (G-MEM) and Iscove's Modified
Dulbecco's Medium. A preferred basal cell culture medium is selected from
DMEM/F12 and RPMI 1640. In a further preferred embodiment, Advanced
DMEM/F12 or Advanced RPMI is used, which is optimized for serum free
culture and already includes insulin. In this case, the Advanced DMEM/F
12 or Advanced RPMI medium is preferably supplemented with glutamine and
Penicillin/streptomycin. In preferred embodiments, the basal medium
comprises Gastrin. In some embodiments, the basal medium also comprises
NAc and/or B27.
[0054] In some embodiments an AO medium as described in WO2016/083613 can
be used. In a particularly preferred embodiment, an AO culture medium
(Table 1) is used, which is supplemented base media suitable to maintain
airway organoids in culture.
[0055] The AO culture medium is base medium supplemented with agents such
as Rspondin (a Wnt agonist), a BMP inhibitor, a TGF-beta inhibitor, a
fibroblast growth factor (FGF) and Nicotinamide.
[0056] In some embodiments, the supplemented basal culture medium used to
culture cells dissociated from a tissue sample does not include a GSK3
inhibitor, for example CHIR99021
(6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidin-
yl]amino]ethyl]amino]-3-pyridinecarbonitrile). Known GSK-inhibitors
comprise small-interfering RNAs, 6-Bromoindirubin-30-acetoxime.
[0057] A preferred AO medium is shown in Table 1.
TABLE-US-00001
TABLE 1
Composition of human airway organoid (AO) medium.
Working
Reagents Company Catalog No. concentration
Advanced DMEM/F12 Invitrogen 12634010 n/a
HEPES Invitrogen 15630-056 1%
GlutaMAX Invitrogen 35050061 1%
Penicillin-Streptomycin Invitrogen 15140-122 1%
Rspondin1* (conditioned n/a n/a 10%
medium)
Noggin* (conditioned n/a n/a 10%
medium)
B27 supplement Invitrogen 17504-044 2%
N-acetylcysteine Sigma A9165 1.25 mM
Nicotinamide Sigma N0636 10 mM
Y-27632 Tocris 1254 5 .mu.M
A8301 Tocris 2939 500 nM
SB202190 Sigma S7067 1 .mu.M
FGF-7 Peprotech 100-19 5 ng/ml
FGF-10 Peprotech 100-26 20 ng/ml
Primocin InvivoGen ant-pm-1 100 .mu.g/ml
Heregulin beta-1 Peprotech 100-03 5 nM
*Conditioned media were produced from stable cell lines for production of
R-spondin1 and Noggin.
[0058] The AO medium incudes a BMP inhibitor. BMP inhibitor is defined as
an agent that binds to a BMP molecule to form a complex wherein the BMP
activity is neutralized, for example by preventing or inhibiting the
binding of the BMP molecule to a BMP receptor. Alternatively, the
inhibitor is an agent that acts as an antagonist or reverse agonist.
BMP-binding proteins that can be used in the disclosed methods include,
but are not limited to Noggin (Peprotech), Chordin and chordin-like
proteins (R&D systems) comprising chordin domains, Follistatin and
follistatin-related proteins (R&D systems) comprising a follistatin
domain, DAN and DAN-like proteins (R&D systems) comprising a DAN
cysteine-knot domain, sclerostin/SOST (R&D systems), decorin (R&D
systems), and alpha-2 macroglobulin (R&D systems). Most preferred BMP
inhibitor is Noggin. Noggin is preferably added to the basal culture
medium at a concentration of at least about 10%.
[0059] The AO medium incudes a WNT agonist. Wnt agonists include the
R-spondin family of secreted proteins, which is include of 4 members
(R-spondin 1 (NU206, Nuvelo, San Carlos, Calif.), R-spondin 2 ((R&D
systems), R-spondin 3, and R-spondin-4); and Norrin. In a preferred
embodiment, a Wnt agonist is selected from the group consisting of:
R-spondin, Wnt-3a and Wnt-6. Preferred concentrations for the Wnt agonist
are about 10% for R-spondin and approximately 100 ng/ml or 100 ng/ml for
WNt-3a. In some preferred embodiments, the WNT agonist is not a GSK
inhibitor.
[0060] SB 202190
(4-(4-Fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)-1H-imidazole) is a
highly selective, potent and cell permeable inhibitor of p38 MAP kinase.
SB 202190 binds within the ATP pocket of the active kinase (K.sub.d=38
nM, as measured in recombinant human p38), and selectively inhibits the
p38a and .beta. isoforms. Other useful p38 MAPK inhibitors include, but
are not limited SB203580
(4-[5-(4-Fluorophenyl)-2-[4-(methylsulfonyl)phenyl]-1H-imidazol-4-yl]pyri-
dine); SB 203580 hydrochloride
(4-[5-(4-Fluorophenyl)-2-[4-(methylsulphonyl)phenyl]-1H-imidazol-4-yl]pyr-
idine hydrochloride); SB202190
(4-[4-(4-Fluorophenyl)-5-(4-pyridinyl)-1H-imidazol-2-yl]phenol); DBM 1285
dihydrochloride
(N-Cyclopropyl-4-[4-(4-fluorophenyl)-2-(4-piperidinyl)-5-thiazolyl]-2-pyr-
imidinamine dihydrochloride); SB 239063
(trans-4-[4-(4-Fluorophenyl)-5-(2-methoxy-4-pyrimidinyl)-1H-imidazol-1-yl-
]cyclohexanol); SKF 86002 dihydrochloride
(6-(4-Fluorophenyl)-2,3-dihydro-5-(4-pyridinyl)imidazo[2,1-b]thiazole
dihydrochloride).
[0061] A8301
(3-(6-Methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1.H-pyrazole-1-carbot-
hioamide) is potent inhibitor of TGF-.beta. type I receptor ALK5 kinase,
type I activin/nodal receptor ALK4 and type I nodal receptor ALK7, A83-01
may be added to the culture medium at a concentration of between 10 nM
and 10 uM, or between 20 nM and 5 uM, or between 50 nM and 1 uM. For
example, A83-01 may be added to the culture medium at approximately 500
nM. Other useful TGF-.beta. type I receptor inhibitors include, but are
not limited to SB431542
(4-[4-(1,3)-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2
yl]benzamide); LY 364947 (4-[3-(2-Pyridinyl)-1H-pyrazol-4-yl]-quinoline);
R 268712 (4-[2-Fluoro-5
[3-(6-methyl-2-pyridinyl)-1/1pyrazol-4-yl]phenyl]-1H-pyrazole-1-ethanol);
SB 525334 (6-[2-(1,1-Dimethylethyl)-5-(6-methyl-2-pyridinyl)-1H-imidazol--
4-yl]quinoxaline); and SB 505124
(2-[4-(1,3-Benzodioxol-5-yl)-2-(1,1-dimethylethyl)-17
imidazol-5-yl]-6-methyl-pyridine)
[0062] Y-27632
(thins-4-[(1R)--I-Aminoethyl]-2%-4-pyridinylcyclohexanecarboxamide
dihydrochloride) is a selective p160ROCK inhibitor. Other useful Rho
inhibitors include isoquinolin and
(S)-(+)-2-methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]-hexahydro-1H-1,4--
diazepine dihydrochloride (H-1152; Tocris Bioscience).
[0063] In particularly preferred embodiments, the AO or PD cell culture
media used in the disclosed methods includes an ErbB3/4 ligand (e.g.
human neuregulin .beta.-1). The ErbB receptor tyrosine kinase family
consists of four cell surface receptors, ErbB1/EGFR HER1, ii) ErbB2/HER2,
iii) ErbB3/HER3, and iv) ErbB4/HER4. ErbB3/4 ligands include members of
the neuregulin/heregulin family. The neuregulin % heregulin family is
referred to herein as the neuregulin family. The neuregulin family is a
family of structurally related polypeptide growth factors that are gene
products of alternatively spliced genes NRG1, NRG2, NRG3 and NRG4. In
more preferred embodiments, the excluded one or more ErbB3/4 ligands of
the culture medium are polypeptides that are gene products of one or more
of NRG1, NRG-2, NRG3 and NRG4 {i.e. a neuregulin polypeptide).
[0064] (iii). PD Culture Medium
[0065] A preferred PD medium is a cell culture medium suitable for
air-liquid interface culture of bronchial epithelial cells. In some
embodiments, the PD medium comprises one or more (or all) of the
components listed in Table 2, preferably at the concentrations shown in
Table 2.
TABLE-US-00002
TABLE 2
Composition of PD medium.
PD medium components Exemplary concentrations
Basal medium 50:50 mixed LHC basal medium and
DMEM medium supplemented with
retinoic acid (50 nM)
EGF 0.5 ng/ml
bovine serum albumin 150 mg/ml
bovine pituitary extract 10 ug/ml
insulin 5 ug/ml
transferrin 10 ug/ml
hydrocortisone 72 ng/ml
triiodothyronine 6.7 ng/ml
epinephrine 0.6 ug/ml
antibiotics Penicillin-Streptomycin (100 U/ml),
Gentamicin (50 ug/ml) and/or
Amphotericin B (0.25 ug/ml)
[0066] In some embodiments, the PD medium is serum free and/or BPE (bovine
pituitary extract)-free. An example of a suitable PD medium is the
commercially available PneumaCult-ALI medium (StemCell Technologies).
PneumaCult.TM.-ALI Medium is a serum- and BPE-free medium for the culture
of human airway epithelial cells at the air-liquid interface (ALI).
Airway epithelial cells cultured in PneumaCult.TM.-ALI Medium undergo
extensive mucociliary differentiation to form a pseudostratified
epithelium that exhibits morphological and functional characteristics
similar to those of the human airway in vivo. PneumaCult.TM.-ALI Medium
supports the generation of differentiated airway organoids in a 2D or 3D
culture system.
[0067] In a particularly preferred embodiment, the PD medium is
supplemented with a notch inhibitor, preferably in a concentration range
between 5 and 30 .mu.M, preferably between 10 and 20 .mu.M and more
preferably about 10 .mu.M.
[0068] Examples of preferred Notch inhibitors that can be used in the
context of this invention are: gamma-secretase inhibitors, such as DAPT
or dibenzazepine (DBZ) or benzodiazepine (BZ) or LY-411575, an inhibitor
capable of diminishing ligand mediated activation of Notch (for example
via a dominant negative ligand of Notch or via a dominant negative Notch
or via an antibody capable of at least in part blocking the interacting
between a Notch ligand and Notch), or an inhibitor of ADAM proteases. In
a particularly preferred embodiment, the notch inhibitor is DAPT
([N--(N-[3,5-difluorophenacetyl]-L-alanyl)-S-phenylglycine t-butyl
ester).
[0069] The isolated cells cultured in AO medium are subsequently cultured
in PD medium for a period of time effective for formation of
PD-organoids. In one preferred embodiment, the time period of time
effective for formation of PD-organoids is from about five to about 20
days. In another preferred embodiment, the period of time effective for
formation of airway organoids is about 14 days.
[0070] B. 2D PD Organoids
[0071] 2D PD organoids may be obtained from 3D airway organoids by a
method that includes dissociating the 3D AO into a single cell
suspension, seeding the cells in transwell inserts and culturing the
cells in AO medium followed by culture in PD medium for a period of time
effective for formation of an intact epithelial barrier, as measured for
example, by a dextran penetration assay. The 3D organoids are dissociated
into single cells using methods known in the art (discussed herein),
preferably, by enzymatic dissociation, followed by shearing and straining
over a filter as disclosed in the Examples.
[0072] The dissociated cells are cultured as a monolayer, preferably on a
permeable support (cell culture insert) in AO medium at 37.degree. C. in
a humidified incubator with 5% CO.sub.2 for 1-2 days and then cultured in
PD medium as a monolayer for a time period between 5 and 16 days,
preferably between 10 and 14 days, and more preferably, for about 12-14
days to obtain 2D PD-organoids. The PD medium is preferably provided on
the apical and basolateral sides of the monolayer. Permeable supports are
commercially available, for example, Corning.RTM. Transwell.RTM..
Transwell inserts are convenient, ready-to-use permeable support devices
pre-packaged in standard multiple well plates. The unique, self-centered
hanging design prevents medium wicking between the insert and outer well.
Transwell inserts are available in a wide variety of sizes, membrane
types, and configurations.
IV. Methods of Using the Composition
[0073] The disclosed 3D and 2D proximal differentiated airway organoids
can morphologically and functionally simulate human airway epithelium.
[0074] Organoids derived from adult stem and progenitor cells reliably
retain their in vivo regenerative activity in vitro, and thus provide
detailed snapshots of tissue restoration after injury. Lung organoids
allow researchers to study processes governing homeostatic regulation of
lung tissue and screen factors that impact lineage-specification of stem
cells.
[0075] Accordingly, the disclosed PD-organoids may be used as an
alternative to live animal testing for compound or for treatment of
(including resistance to treatment of) lung infection or disease (e.g.,
chronic obstructive pulmonary disease (COPD)).
[0076] Influenza virus infection represents a major threat to public
health worldwide. The disclosed 3D and 2D proximal differentiated airway
organoids can morphologically and functionally simulate human airway
epithelium and can discriminate human infective influenza viruses from
poorly infective viruses. Thus, the proximal differentiated airway
organoids can be utilized to determine the infectivity of influenza
viruses and significantly extend advances in influenza research and
provide solutions to influenza infection. One of the most important and
challenging issues for infectious disease research, for example,
influenza research is to predict which animal or emerging influenza virus
can infect humans. In one embodiment, a method for determining
infectivity of a pathogen for example a non-human strain of the influenza
virus in humans, by comparing infectivity of the non-human virus in the
disclosed 3D or 2D differentiated airway organoids, and comparing its
infectivity with a strain of that pathogen known to be highly infectious
in humans (high infectivity control) and a strain of that pathogen known
have no or low infectivity in humans (low-infectivity control). For
example, human infective H7N9/Ah and H1N1pdm can be used as positive
control and H7N2 or swine H1N1 used as negative control to determine
compare their replication in the 2D or 3D organoids compared to the virus
whose infectivity in humans is being tested. Replication in the 2D or 3D
organoid comparable with H7N9/Ah and H1N1pdm, indicates that the virus
being tested would be infective in humans. Conversely, replication
comparable to H7N2 or swine H1N1 indicates that the virus being tested
would be low infectivity in humans.
[0077] For acute treatment testing, compound or vaccine may be applied to
the PD-organoid, e.g., once for several hours. For chronic treatment
testing, compound or vaccine may be applied, e.g., for days to one week.
Such testing may be carried out by providing an airway organoid product
as described herein under conditions which maintain constituent cells of
that product alive (e.g., in a culture media with oxygenation); applying
a compound to be tested (e.g., a drug candidate) to the lung PD-organoid
(e.g., by topical or vapor application to the epithelial layer); and then
detecting a physiological response (e.g., damage, infection, cell
proliferation, cell death, marker release such as histamine release,
cytokine release, changes in gene expression, etc.), the presence of such
a physiological response indicating said compound or vaccine has
therapeutic efficacy, toxicity, or other metabolic or physiological
activity if inhaled or otherwise delivered into the airway of a mammalian
subject. A control sample of the PD-organoid may be maintained under like
conditions, to which a control compound (e.g., physiological saline,
compound vehicle or carrier) may be applied, so that a comparative result
is achieved, or damage can be determined based on comparison to historic
data, or comparison to data obtained by application of dilute levels of
the test compound, etc.
[0078] In some preferred embodiment, the disclosed PD-organoid is can be
used for influenza virus testing (infectivity and vaccines). In a
particularly preferred embodiment, the disclosed PD-organoid can
discriminate human infective influenza viruses from poorly infective
viruses. Thus, the proximal differentiated airway organoids can be
utilized to predict the infectivity of influenza viruses and
significantly extend the current armamentaria of influenza research
toolbox.
[0079] Pre-clinical models of human disease are essential for the basic
understanding of disease pathology and its translational application into
efficient treatment for patients. Patient-derived organoid cultures from
biopsies and/or surgical resections can be used for personalized
medicine. Two examples are lung cancer and cystic fibrosis. Additionally,
tissue samples can be obtained from a subject cultured as disclosed
herein and used to determine the subject's responsiveness to medication
in order to select the better treatment for that subject. Dekkers et al.
Science Translational Medicine, 8(344):344ra84 (2016) showed that the
efficacy of cystic fibrosis transmembrane conductance regulator
(CFTR)-modulating drugs can be individually assessed in a laboratory test
using epithelial cells cultured as mini-guts from rectal biopsies from
subjects with cystic fibrosis. The authors show that the drug responses
observed in mini-guts or rectal organoids can be used to predict which
patients may be potential responders to the drug. Similar preclinical
tests using the disclosed 3D organoids obtained from a subject may help
to quickly identify responders to CFTR-modulating drug therapy even when
patients carry very rare CFTR mutations.
[0080] Ex vivo expanded adult stem cell-derived organoids retain their
organ identity and genome stability, and can be differentiated to PD lung
organoids as described herein. Therefore, the PD-organoids may also be
used for replacing damaged tissues.
[0081] Airway organoids can easily be established from bronchiolar lavage
material of humans, allowing inter-individual comparisons; airway
organoids can also be readily modified by lentiviruses and CRISPR
technologies and can be single cell-cloned. In combination with the
molecular toolbox of influenza virologist, the human differentiated
airway organoid model system offers great opportunities for studying
virus and host factors that define characteristics of this major animal
and human pathogen.
[0082] The present invention will be further understood by reference to
the following non-limiting examples.
V. Examples
[0083] A. Materials and Methods
[0084] Establishing Adult Stem Cell-Derived Human Airway Organoids.
[0085] Generation of adult stem cells (ASC) derived human airway organoids
was based on the following protocol. Briefly, upon ethical approval by
Institutional Review Board of the University of Hong Kong/Hospital
Authority Hong Kong West Cluster (HKU/HA HKW IRB, UW 13-364) and informed
consents of patients, small pieces of normal lung tissues around 0.5-0.8
cm in size and adjacent to the diseased tissues, were obtained from
patients who underwent surgical operation. The tissues were minced and
digested with 2 mg/ml collagenase (Sigma Aldrich) for 1-2 hours at
37.degree. C., followed by shearing using glass Pasteur pipette and
straining over a 100 .mu.m filter. The resultant single cells were
embedded in 60% MATRIGEL.TM. and were seeded in 24-well suspension
culture plate. After solidification, MATRIGEL.TM. droplets containing
single cells were maintained with airway organoid (AO) culture medium
(Table 1) at 37.degree. C. in a humidified incubator with 5% CO.sub.2.
The organoids were passaged every 2-3 weeks. The bright field images of
the organoids were acquired using Nikon Eclipse TS100 Inverted Routine
Microscope. To generate PD organoids, airway organoids were split and
cultured in AO medium for 2-7 days, following which the culture medium
was changed to PD medium.
[0086] Proximal Differentiation of Human Airway Organoids.
[0087] The airway organoids were split and maintained in AO medium for 2-7
days. The culture media in half of the organoids were changed to proximal
differentiation (PD) medium, PneumaCult-ALi medium (StemCell
Technologies) supplemented with 10 .mu.M DAPT, a notch pathway inhibitor
(Tocris). The organoids were then cultured AO or PD media for 16 days, to
obtain 3D AO-airway organoids and 3D-PD airway organoids, respectively.
Bright field images were taken every 3 days. Diameters of individual
organoids were measured with ImageJ. The movies of organoids were
acquired using Total Internal Reflection Fluorescent (TIRF) Microscope
and Nikon Eclipse Ti2 Inverted Microscope System. At the indicated days,
the organoids in the different media were harvested for detection of
cellular gene expression or applied to flow cytometry analysis.
[0088] Establishing 2D Differentiated Airway Organoids with Transwell
Culture.
[0089] Transwell culture of airway organoids was performed as described
elsewhere (24, 25) with modifications. Briefly, the 3D airway organoids
were dissociated into single cell suspension after digested with
10.times.TrypLE.TM. Select Enzyme (Invitrogen) for 1.about.5 min at
37.degree. C., sheared using Pasteur pipette and strained over a 40 .mu.m
filter. Approximately 3.5.times.10.sup.5 cells were seeded into each
transwell insert (Corning, product #3494). The cells were cultured in AO
medium at 37.degree. C. in a humidified incubator with 5% CO.sub.2 for
1-2 days. When cells reached >90% confluence, the AO medium was
changed to PD medium in both the apical and basal chambers. The medium
was changed every other day and the cells were maintained for 14 days.
Trans-epithelial electronic resistance (TEER) was measured every other
day using Millicell ERS-2 Volt-Ohm Meter (EMD Millipore). To assess the
integrity of the 2D organoid monolayer as an epithelial barrier, at day
12 after seeding, fluorescein isothiocyanate-dextran with an average
molecular weight of 10,000 (Sigma Aldrich) was added in the medium of
upper chamber at a concentration of 1 mg/ml and incubated at 37.degree.
C. for 4 hours. Subsequently, the culture media were harvested from the
upper and bottom chambers to detect the fluorescence intensity using the
Victor XIII Multilabel Reader (PerkinElmer).
[0090] Propagation of Influenza a Viruses.
[0091] Influenza A virus A/Anhui/1/2013(H7N9) (H7N9/Ah), A/Hong
Kong/415742/2009(H1N1) (H1N1pdm) and swine H1N1 isolate (H1Nsw) were
propagated in Madin-Darby Canine Kidney (MOCK) cells. At 72 hours post
inoculation (hpi), cell-free medium was harvested, aliquoted and stored
at -80.degree. C. Avian IAVs H7N2 and Viet Nam/1194/04 (H5N1) was
propagated in special pathogen-free embryonated chicken eggs at
37.degree. C. for 36 hours. The eggs were chilled for overnight at
4.degree. C.; then the virus-containing allantoic fluid was harvested,
aliquoted and stored at -80.degree. C. Virus titer was determined by
plaque assay.
[0092] Influenza a Virus Infection in Human Airway Organoids.
[0093] The 3D airway organoids were sheared mechanically to expose the
apical surface to the virus inoculum. The sheared organoids were then
incubated with viruses at a multiplicity of infection (MOI) of 0.01for 2
hours at 37.degree. C. After washing, the inoculated organoids were
re-embedded into MATRIGEL.TM. and then cultured in the PD medium. In the
H7N9/Ah and H7N2 infection in the 3D PD organoids, one set of
H7N9/Ah-inoculated organoids were treated with a serine proteases
inhibitor AEBSF (0.125 mM, Merck Millipore) during inoculation and after
inoculation. At the indicated hpi, organoids, dissolved MATRIGEL.TM. and
culture medium were harvested for detection of viral load. The cell-free
MATRIGEL.TM. and the culture medium from each droplet were pooled
together as one sample, referred as supernatant. The supernatant samples
were also used for viral titration. The 2D PD airway organoids were
inoculated with the indicated viruses at an MOI of 0.001, from the apical
side by adding the virus inoculum into the apical chamber and incubating
for 2 hours at 37.degree. C. At the indicated hpi, cell-free media were
collected from apical and basolateral chambers for subsequent viral
titration. The membranes seeded with 2D organoids were incised from
transwell inserts, fixed and applied to immunofluorescence staining as
described previously (13).
[0094] RNA Extraction, Reverse Transcription and Quantitative Polymerase
Chain Reaction (RT-qPCR).
[0095] To evaluate the differentiation status of airway organoids cultured
in PD medium versus those in AO medium, the organoids were harvested at
the indicated hours and applied to RNA extraction using MiniBEST
Universal RNA extraction kit (TaKaRa). To evaluate virus replication, the
organoids and supernatant samples were lysed for RNA extraction using
MiniBEST Universal RNA extraction kit and MiniBEST Viral RNA/DNA
Extraction Kit (TaKaRa) respectively. Complementary DNA (cDNA) was
synthesized with Transcriptor First Strand cDNA Synthesis Kit (Roche)
with Oligo-dT primer. qPCR was performed with LightCycler 480 SYBR Green
I Master (Roche) using gene specific primers (Table 3) to detect cellular
gene expression level and viral gene copy number. The mRNA expression
levels of cellular genes were normalized with that of GAPDH. Viral gene
copy number was determined by absolute quantification using a plasmid
expressing a conserved region of IAV M gene.
TABLE-US-00003
TABLE 3
Primers for quantitative PCR assay.
Gene Name Primer Sequence
p63 (TP63) F CAGACTCAATTTAGTGAGCC (SEQ
ID NO: 1)
R CTGCTGGTCCATGCTGTT (SEQ ID
NO: 2)
keratin 5 (KRT5) F GAGGAATGCAGACTCAGTGGA
(SEQ ID NO: 3)
R TAGCTTCCACTGCTACCTCCG (SEQ
ID NO: 4)
forkhead box J1 F TCGTATGCCACGCTCATCTG (SEQ
(FOXJ1) ID NO: 5)
R CGGATTGAATTCTGCCAGGT (SEQ
ID NO: 6)
sentan, cilia F GCTGCAAACCCAATTTAGGA (SEQ
apical structure ID NO: 7)
protein (SNTN)* R TGCTCATCAAGTTCAGAAAGGA
(SEQ ID NO: 8)
mucin 5AC, F CCTACAAAGCTGAGGCCTGT (SEQ
oligomeric ID NO: 9)
mucus/gel- R GACCCTCCTCTCAATGGTGC (SEQ
forming ID NO: 10)
(MUC5AC)
secretoglobin F AGCATCATTAAGCTCATGGAAAAA
family 1A (SEQ ID NO: 11)
member 1 R GTGGACTCAAAGCATGGCAG (SEQ
(SCGB1A1) ID NO: 12)
secretoglobin F AACTGCTGGAGGCGCTATCA (SEQ
family 3A ID NO: 13)
member 2 R TGTCCTTTTCACGGGTCACT (SEQ
(SCGB3A2) ID NO: 14)
transmembrane F CTTTGAACTCAGGGTCACCA (SEQ
protease, serine 2 ID NO: 15)
(TMPRSS2) R TAGTACTGAGCCGGATGCAC (SEQ
ID NO: 16)
transmembrane F TGCTTCAGGAAACATACCGA (SEQ
protease, serine 4 ID NO: 17)
(TMPRSS4) R CTGGAGTGAGCTCCTCATCA (SEQ
ID NO: 18)
transmembrane F TACACAGGAATACAGGACTT (SEQ
protease, serine ID NO: 19)
11D R CTCACACCACTACCATCT (SEQ ID
(TMPRSS11D) NO: 20)
Matriptase F CTAGGATGAGCAGCTGTGGA (SEQ
ID NO: 21)
R AAGAATTTGAAGCGCACCTT (SEQ
ID NO: 22)
IAV M gene F CTTCTAACCGAGGTCGAAACG
(SEQ ID NO: 23)
R GGCATTTTGGACAAAKCGTCTA
(SEQ ID NO: 24)
[0096] Plaque Assay.
[0097] Plaque assay was performed to determine titers of the virus stocks
and supernatant samples as described elsewhere with minor modification
(26). Briefly, MDCK cells were seeded in 12-well plates. Confluent
monolayers were inoculated with 200 .mu.L of 10-fold serial dilutions of
samples and incubated for 1 hour at 37.degree. C. After removing the
inoculum, the monolayers were overlaid with 1% LMP Agarose (Invitrogen)
supplemented with MEM and 1 .mu.g/.mu.1 TPCK-treated Trypsin and further
incubated for 2-3 days. The monolayers were fixed with 4% PFA and stained
with 1% crystal violet to visualize the plaque after removing the agarose
plugs. Virus titers were calculated as plaque-forming units (PFU) per
milliliter.
[0098] Immunofluorescence Staining
[0099] To identify the indicated cell types and the virus-infected cells,
the 3D and 2D airway organoids were applied to immunofluorescence
staining. Briefly, the organoids fixed with 4% PFA, permeabilized with
0.1-5% Triton X-100 and blocked with Protein block (Dako). Then the
organoids were incubated with primary antibodies (Table 4) diluted in
Antibody Diluent buffer (Dako) overnight at 4.degree. C., followed by
incubation with secondary antibody (Table 4) for 1.about.2 hours at room
temperature. Nuclei and actin filaments were counterstained with
4'-6-diamino-2-phenylindole (DAPI) (Invitrogen) and Phalloidin-647 (Sigma
Aldrich) respectively. The confocal images were acquired using Carl Zeiss
LSM 780 or 800.
TABLE-US-00004
TABLE 4
List of Antibodies for used for incubation.
Antibodies Company Catalog No.
Mouse Anti-Cytokeratin 5 Abcam ab128190
Rabbit Anti-p63 Abcam ab124762
Mouse Anti-.beta.-tubulin 4 Sigma T7941
Mouse Anti-FOX J1 Invitrogen 14-9965-82
Mouse Anti-Mucin 5AC Abcam ab3649
Rat Anti-Uteroglobin/CC-10 R&D Systems MAB4218-SP
Rabbit Anti-Influenza A NP Novus NBP2-16965
Goat Anti-Mouse, Alexa Fluor 488 Invitrogen A11001
Goat Anti-Mouse Alexa Fluor 594 Invitrogen A11005
Goat Anti-Rabbit Alexa Fluor 488 Invitrogen A11034
Goat Anti-Rabbit Alexa Fluor 594 Invitrogen A11037
Goat Anti-Rat Alexa Fluor 594 Invitrogen A11007
[0100] Flow Cytometry Analysis.
[0101] To assess the percentage of four types of cells, the airway
organoids were applied to flow cytometry analysis. Briefly, the organoids
were dissociated with 10 mM EDTA (Invitrogen) for 30.about.60 minutes at
37.degree. C., fixed with 4% PFA and permeabilized with 0.1% Triton-100.
Subsequently, the cells were incubated with primary antibodies (Table 4)
for 1 hour at 4.degree. C. and followed by secondary antibodies staining.
BD FACSCantoII Analyzer was used to analyze the samples.
[0102] Statistical Analysis
Student's t test was used for data analysis. P<0.05 was considered to
be statistically significant.
[0103] B. Results
[0104] Characterization of the Human Airway Organoids.
[0105] Several lines of airway organoids (3D cysts lined by polarized
epithelium) were established as discussed briefly above, using the OA
culture medium, the lung cell culture medium disclosed in U.S. Published
Application No. 2017/275592. The four main types of airway epithelial
cells were present, i.e. ciliated cell (ACCTUB+ or FOXJ1+), basal cell
(P63+), goblet cell (MUC5AC+), and Club cell (CC10+). Apical ACCTUB
clearly indicated the orientation of polarization. Most organoids were
orientated inwards the lumen; while a small proportion of the organoids
were inverted. Beating cilia were visible. No type I and type II alveolar
epithelial cells was present. Thus, these organoids resembled the
pseudostratified ciliated airway epithelium. The airway organoids were
infected by human IAV H1N1pdm, low pathogenic avian virus H7N9/Ah and
highly pathogenic avian virus H5N1 (FIGS. 1A-1C). The intracellular (cell
lysate) viral loads of all 3 virus strains increased over 2 log.sub.10
units (FIG. 1A). The extracellular (supernatant) viral loads (FIG. 1B),
especially the viral titers (FIG. 1C), were elevated by 2-3 log.sub.10
units.
[0106] Ciliary beating plays essential roles in human airway biology and
pathology, and 50%-80% of airway epithelial cells are ciliated (Yaghi, et
al., Cells, 5(4): pii:E402016)). However, by immunostaining and flow
cytometry, ciliated cells were apparently under-represented in these
airway organoids. Therefore, despite the discernible multi-lineage
differentiation and the ability to support replication of IAVs, further
improvement of morphology and differentiation appeared required.
Furthermore, when these AO-organoids are passaged over time, less and
less cilia can be observed. After consecutively passaging 3 months, cilia
are not detectable.
[0107] Proximal Differentiation of the Airway Organoids.
[0108] To improve proximal differentiation, various protocols and
variations thereof were investigated, selecting a proximal
differentiation (PD) medium supplemented with DAPT
([N--(N-[3,5-difluorophenacetyl]-L-alanyl)-S-phenylglycine t-butyl ester
to induce ciliary differentiation. The organoids in the original airway
organoid (AO) medium gradually enlarged, whilst those in PD medium became
more compact. After 16 days of culture, the organoids in AO medium grew 2
times larger approximately, while the PD organoids basically remained
unchanged (FIG. 2). From day 7, numbers of ciliated cells increased
markedly in PD medium. At day 16, beating cilia were observed in a
minority of (<10%) the organoids in AO medium, whilst abundant beating
cilia were present in every PD organoid. The synchronously beating cilia
drove the cell debris within the organoid lumens to swirl
unidirectionally. The dramatically increased abundance of ciliated cells
in the PD organoids was verified by immunofluorescence staining. This is
in contrast to the 3D organoids obtained from LBO (lung bud organoids)
disclosed in Chen, et al., Nat Cell Biol 19(5):542-549, (2017), where in
vitro cultures are strongly biased towards distal lung, and, although
some areas co-expressing SOX2 and SOX9 expressed more proximal markers
for goblet cells and club cell precursors, mature club cells, ciliated
cells or basal cells were not observed. Nikolic, et al., Elife 6: e26575
(2017))
[0109] Consistently, the transcriptional levels of ciliated cell markers,
FOXJ1 and SNTN, were strongly upregulated in the PD organoids compared
with the organoids in AO medium. The expression levels of basal cell
markers (P63, CK5) and goblet cell marker (MUC5AC) also increased;
whereas the levels of Club cell markers (CC10, SCGB3A2) were
substantially downregulated in the PD organoids (FIGS. 3A and 3B).
Importantly, globally elevated expression of serine proteases including
TMPRSS2, TMPRSS4, TMPRSS11D (HAT) and Matriptase was observed, which are
essential for the activation and propagation of human IAVs and low
pathogenic avian IAVs (8). Flow cytometry analysis was also performed to
measure the percentages of the four cell types in the organoids cultured
in two distinct media at day 16. It was shown that, the percentage of
ciliated cell remarkably increased around 3-fold after proximal
differentiation, to over 40% in the PD organoids; while the ciliated
cells invariably constituted a minority of the cells in the organoids in
AO medium (FIGS. 3C and 3D). Goblet cells also marginally increased;
while Club cells consistently decreased after proximal differentiation
(FIGS. 3C and 3D). Collectively, mucociliary differentiation and
developed proximal differentiated airway organoids which can
morphologically and functionally simulate human airway epithelium was
successfully induced in the original airway organoids.
[0110] Proximal Differentiated Airway Organoids can Identify Human
Infective Virus.
[0111] One of the most important and challenging issues for influenza
research is to predict which animal or emerging influenza virus can
infect humans. As mentioned above, the novel reassortant avian H7N9
viruses have caused continuing poultry-to-human transmission since 2013.
Other subtypes of avian IAVs (including H7N2, H9N2 and H9N9) have been
co-circulating with the H7N9 viruses in domestic poultry. These viruses
are highly similar in internal genes; yet differ in neuraminidase (NA) or
HA and NA (18). Very few human infections by H7N2, H9N2 and H9N9 virus
have been reported in the same territory and time frame although people
were exposed to these viruses equivalently as to the H7N9 viruses (19),
suggesting that these viruses are less-infective to humans than the H7N9
viruses.
[0112] These co-circulating viruses were isolated, plaque purified and
genotyped. H7N2 and H7N9/Ah was chosen to compare their infectivity in
the PD organoids, with the hypothesis that the differentiated airway
organoids can indeed simulate human airway epithelium in the context of
influenza virus infection. FIG. 4A-C showed that viral loads in the cell
lysate and medium of H7N9/Ah-infected organoids gradually increased after
inoculation; the viral titer increased more than 3 log.sub.10 units
within 24 hours, indicating a robust viral replication. The addition of
serine protease inhibitor AEBSF significantly restricted the active
replication of H7N9/Ah virus, highlighting the importance of elevated
serine proteases for viral replication. In contrast, H7N2 modestly
propagated with viral titer 2-3 log.sub.10 units lower than H7N9/Ah.
Thus, the distinct efficiency of H7N9/Ah and H7N2 to infect and replicate
in proximal differentiated airway organoids can recapitulate infectivity
of these viruses in humans.
[0113] Establishing 2D Airway Monolayer from Airway Organoids to Assess
the Infectivity of IAVs.
[0114] 3D organoids were transformed into a 2D monolayer using transwell
culture. To this end, 3D airway organoids were enzymatically dissociated
into single cell suspension, seeded in transwell inserts and then
cultured in PD medium. The trans-epithelial electronic resistance (TEER)
in the 2D monolayers stabilized in the second week after seeding (FIGS.
5A and 5B). In addition, the dextran penetration assay performed at day
12 indicated that an intact epithelial barrier was formed cross the 2D
monolayers (FIGS. 5A and 5B). The intense signal of ACCTUB indicated that
the 2D monolayers developed appreciable proximal differentiation. The
productive infection of H7N9/Ah was clearly shown by the virus
nucleoprotein (NP) positive cells at 8 hours post infection (hpi).
[0115] The replication capacity of H7N9/Ah and H7N2 in the 2D PD organoids
was compared. To further verify the ability of 2D PD organoids for
assessing zoonotic potential of animal viruses, and identifying the
human-infective virus, the replication capacity of H7N9/Ah and H7N2 in
the 2D PD organoids, as well as another pair of viruses, the highly human
infective H1N1pdm and a swine H1N1 isolate (H1N1sw) were analyzed. The
higher replication capacity of H7N9/Ah over H7N2 virus was more
pronounced in the 2D PD organoids than in the 3D PD organoids; the viral
titer of H7N9/Ah in the apical media was 3-4 log.sub.10 units higher than
that of the H7N2 virus (FIGS. 5C and 5D). Consistently, H1N1pdm
dramatically replicated with viral titer in apical media 1-2 log.sub.10
units higher than H1N1sw. Due to the epithelial barrier formed in the 2D
monolayers and the preferential virus release from the cell apical side,
the viral titers in the basolateral media were consistently lower than
those in apical media at the corresponding time points. Nevertheless, the
differences in replication capacity between H7N9/Ah versus H7N2, H1N1pdm
versus H1N1sw were even more prominent in basal media than in apical
media in most time points.
[0116] C. Discussion
[0117] This study describes proximal differentiation of human ASC-derived
airway organoid culture for studies of a major pathogen, the influenza
virus. In particular, the disclosed differentiation conditions increase
the numbers of ciliated cells (FIGS. 3A and 3C), and the major cell type
in the human airway epithelium. The PD medium induces ciliated cell
numbers to a near-physiological level, with synchronously beating cilia
readily discernible in every organoid. In addition, the expression levels
of serine proteases (FIG. 3B) known to be important for productive viral
infection, were elevated after proximal differentiation. Among the
upregulated HA-activating serine proteases, the dramatically increased
expression of HAT in the differentiated airway organoids is very likely
attributed to the increased abundance of ciliated cells since ciliated
cells are the main source of HAT in the human respiratory tract (Krueger,
et al., Swine Influenza Virus Infections in Man. Swine Influenza, eds
Richt JA & Webby RJ (Springer Berlin Heidelberg, Berlin, Heidelberg), pp
201-225 (2013)). Thus, the differentiated airway organoids can
morphologically and functionally simulate the human airway epithelium. As
a further improvement, 2D PD airway monolayers were developed, with an
intact epithelial barrier to allow exclusive apical exposure to viruses
(FIGS. 5A and 5B), the natural mode of IAV infection in the human
respiratory tract. Two pairs of viruses with known infectivity were
utilized to demonstrate, as a proof-of-concept, that these organoids
indeed show significantly higher susceptibility to the human-infective
viruses than the poorly human-infective viruses. These 3D and 2D
differentiated airway organoids support active replication of human
infective H7N9/Ah and H1N1pdm. In contrast, the H7N2 virus, which has
been temporally and spatially co-circulating with H7N9 viruses in
domestic poultry and contains the similar internal genes as H7N9 viruses,
replicated much less efficiently in both models. Similarly, the swine
H1N1 isolate showed a lower growth capacity than its counterpart of
human-adapted H1N1pdm (FIGS. 5C and 5D).
[0118] The avian IAV H7N2 subtype viruses circulating in the bird market
between 1994-2006 caused poultry outbreaks in the US. Sporadic human
infections have been reported in the US and Europe. Fortunately, all
reported human infection cases experienced mild influenza-like symptoms
(Marinova-Petkova, et al., Emerg Infect Dis 23(12) (2017)). While pigs
are considered to be the intermediate hosts for interspecies transmission
of IAVs, swine influenza viruses lacking human adaptation markers rarely
infect humans. Sporadic human infections documented in the literatures or
reported by public health officials are generally mild or subclinical
(Krueger, et al., Swine Influenza Virus Infections in Man. Swine
Influenza, eds Richt JA & Webby RJ (Springer Berlin Heidelberg, Berlin,
Heidelberg), pp 201-225 (2013)). The ability of the PD airway organoids
to differentiate avian H7 subtype virus and swine H1 subtype virus from
the counterpart human viruses suggest that these models could be used for
assessment of cross-species transmission potential of emerging influenza
virus in humans.
[0119] In summary, these differentiated airway organoids significantly
extend the current armamentaria of influenza research toolbox.
[0120] Unless defined otherwise, all technical and scientific terms used
herein have the same meanings as commonly understood by one of skill in
the art to which the disclosed invention belongs. Publications cited
herein and the materials for which they are cited are specifically
incorporated by reference. Those skilled in the art will recognize, or be
able to ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the following
claims.
Sequence CWU
1
1
24120DNAArtificial Sequencesynthetic sequence 1cagactcaat ttagtgagcc
20218DNAArtificial
Sequencesynthetic sequence 2ctgctggtcc atgctgtt
18321DNAArtificial Sequencesynthetic sequence
3gaggaatgca gactcagtgg a
21421DNAArtificial Sequencesynthetic sequence 4tagcttccac tgctacctcc g
21520DNAArtificial
Sequencesynthetic sequence 5tcgtatgcca cgctcatctg
20620DNAArtificial Sequencesynthetic sequence
6cggattgaat tctgccaggt
20720DNAArtificial Sequencesynthetic sequence 7gctgcaaacc caatttagga
20822DNAArtificial
Sequencesynthetic sequence 8tgctcatcaa gttcagaaag ga
22920DNAArtificial Sequencesynthetic sequence
9cctacaaagc tgaggcctgt
201020DNAArtificial Sequencesynthetic sequence 10gaccctcctc tcaatggtgc
201124DNAArtificial
Sequencesynthetic sequence 11agcatcatta agctcatgga aaaa
241220DNAArtificial Sequencesynthetic sequence
12gtggactcaa agcatggcag
201320DNAArtificial Sequencesynthetic sequence 13aactgctgga ggcgctatca
201420DNAArtificial
Sequencesynthetic sequence 14tgtccttttc acgggtcact
201520DNAArtificial Sequencesynthetic sequence
15ctttgaactc agggtcacca
201620DNAArtificial Sequencesynthetic sequence 16tagtactgag ccggatgcac
201720DNAArtificial
Sequencesynthetic sequence 17tgcttcagga aacataccga
201820DNAArtificial Sequencesynthetic sequence
18ctggagtgag ctcctcatca
201920DNAArtificial Sequencesynthetic sequence 19tacacaggaa tacaggactt
202018DNAArtificial
Sequencesynthetic sequence 20ctcacaccac taccatct
182120DNAArtificial Sequencesynthetic sequence
21ctaggatgag cagctgtgga
202220DNAArtificial Sequencesynthetic sequence 22aagaatttga agcgcacctt
202321DNAArtificial
Sequencesynthetic sequence 23cttctaaccg aggtcgaaac g
212422DNAArtificial Sequencesynthetic sequence
24ggcattttgg acaaakcgtc ta
22
* * * * *
![[Image]](/netaicon1/PTO/image.gif)
![[Order Copy]](/netaicon1/PTO/order.gif)
![[PREV_LIST]](/netaicon1/PTO/prevlist.gif)
![[CURR_LIST]](/netaicon1/PTO/hitlist.gif)
![[NEXT_LIST]](/netaicon1/PTO/nextlist.gif)
![[PREV_DOC]](/netaicon1/PTO/prevdoc.gif)
![[NEXT_DOC]](/netaicon1/PTO/nextdoc.gif)
![[Help]](/netaicon1/PTO/help.gif)
![[Home]](/netaicon1/PTO/home.gif)
![[Boolean Search]](/netaicon1/PTO/boolean.gif)
![[Manual]](/netaicon1/PTO/manual.gif)
![[Number Search]](/netaicon1/PTO/number.gif)
![[PTDLs]](/netaicon1/PTO/ptdl.gif)
