Immunogenic compositions comprising viral vectors and surfactants are
provided. Methods for administration and preparation of such compositions
are also provided.
| Inventors: |
CROYLE; Maria A.; (Austin, TX)
; SCHAFER; Stephen Clay; (Austin, TX)
|
| Applicant: | | Name | City | State | Country | Type |
BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM |
Austin |
TX |
US | | |
|---|
| Family ID:
|
57111169
|
| Appl. No.:
|
15/907259
|
| Filed:
|
February 27, 2018 |
Related U.S. Patent Documents
| | | | |
|---|
|
| Application Number | Filing Date | Patent Number |
|---|
| | 15081601 | Mar 25, 2016 | 9974850 |
| | 15907259 | | |
| | 62137922 | Mar 25, 2015 | |
|
|
| Current U.S. Class: |
1/1 |
| Current CPC Class: |
A61K 2039/55555 20130101; C12N 15/88 20130101; A61K 39/39 20130101; C12N 2710/10351 20130101; Y02A 50/30 20180101; C12N 2710/10343 20130101; A61K 2039/543 20130101; C12N 2760/14134 20130101; C12N 7/00 20130101; A61K 39/12 20130101; C12N 2760/16134 20130101; C12N 2710/10371 20130101 |
| International Class: |
A61K 39/12 20060101 A61K039/12; C12N 15/88 20060101 C12N015/88 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under Grant no. U01
AI078045 awarded by National Institutes of Health, NIAID. The government
has certain rights in the invention.
Claims
1. An immunogenic composition comprising a recombinant virus vector
comprising an expression cassette encoding a heterologous antigen, said
recombinant virus vector formulated in a substantially solid carrier
comprising: (i) PMAL-C16 or (ii) from about 0.1% to 10% of a zwitterionic
surfactant.
2-24. (canceled)
25. A method for providing an immune response in a mammal comprising: (a)
obtaining a composition in accordance with claim 1, which has been
dispersed in a pharmaceutically acceptable liquid; and (b) administering
an effective amount of the dispersed composition a mammal.
26. The method of claim 25, wherein the administering comprises
administering the dispersed composition to a mucosal tissue of the
mammal.
27. The method of claim 26, wherein the administering is by oral,
sublingual, buccal or intranasal administration.
28. The method of claim 27, wherein the administering is by intranasal
administration.
29. The method of claim 25, wherein the pharmaceutically acceptable
liquid is distilled deionized water.
30. The method of claim 25, wherein the composition dispersed in the
liquid comprises about 0.1 to 50 mg/ml of the zwitterionic surfactant.
31. The method of claim 30, wherein the composition dispersed in the
liquid comprises about 1 to 20 mg/ml of the zwitterionic surfactant.
32. The method of claim 25, wherein the composition dispersed in the
liquid comprises about 0.1 to 50 mg/ml of PMAL-C16.
33. The method of claim 33, wherein the composition dispersed in the
liquid comprises about 1 to 20 mg/ml of PMAL-C16.
34. The method of claim 25, wherein obtaining the composition comprises
solubilizing the solid composition in an aqueous liquid.
35. The method of claim 34, wherein solubilizing the solid composition in
an aqueous liquid comprises contacting the solid with the aqueous liquid
and incubating the solid and aqueous liquid for 1 to 15 minutes.
36. The method of claim 25, wherein virus vector is an adenovirus 5
vector.
37. The method of claim 36, wherein the subject has been previously
exposed to adenovirus 5.
38. A method of making a stabilized immunogenic composition comprising:
(a) formulating a solution comprising a recombinant virus vector in a
pharmaceutically acceptable carrier said carrier comprising: (i) PMAL-C16
or (ii) from about 0.1% to 10% of a zwitterionic surfactant; and (b)
drying the solution to provide a stabilized immunogenic composition.
39-75. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of U.S. patent application Ser. No.
15/081,601, filed Mar. 25, 2016, which claims the benefit of U.S.
Provisional Patent Application No. 62/137,922, filed Mar. 25, 2015, the
entirety of each of which is incorporated herein by reference. This
application is also related to U.S. patent application Ser. No.
13/750,774, filed Jan. 25, 2013, the entirety of which is incorporated
herein by reference.
INCORPORATION OF SEQUENCE LISTING
[0003] The sequence listing that is contained in the file named
"UTSBP1053USD1_ST25.txt", which is 2 KB (as measured in Microsoft
Windows.RTM.) and was created on Feb. 27, 2018, is filed herewith by
electronic submission and is incorporated by reference herein.
BACKGROUND
[0004] Vaccination has increased the average human lifespan worldwide more
than 10 years during the 20th century. Breakthroughs in immunology,
molecular biology and biochemistry in the last 25 years produced more
than half of the vaccines used during the last 100 years. Despite this,
little progress has been made in delivery since most are injectable and
require strict maintenance of cold chain conditions.
[0005] Injectable vaccines have various drawbacks. Injections are the most
common reason for iatrogenic pain in childhood and deter many from
immunization. Injectable vaccines pose a significant risk to the safety
of medical staff, patients and community. And most vaccines are unstable
at ambient temperatures and require refrigeration.
SUMMARY
[0006] In a first embodiment, there is provided an immunogenic composition
comprising a recombinant virus vector (e.g., a recombinant virus vector
comprising an expression cassette encoding a heterologous antigen), said
recombinant virus vector formulated in a pharmaceutically acceptable
carrier comprising: (i) PMAL-C16 or (ii) from about 0.1% to 10 of a
zwitterionic surfactant. In some aspects, the pharmaceutically acceptable
carrier comprises PMAL-C16, such as about 0.1 to 50 mg/ml, 1 to 40 mg/ml,
1 to 30 mg/ml, 1 to 20 mg/ml, or 5 to 15 mg/ml (e.g., about 10 mg/ml) of
PMAL-C16. In further aspects, the pharmaceutically acceptable carrier
comprises about 0.1% to 10%, 0.5% to 10%, 0.5% to 5%, 1% to 10%, or 1% to
5% of PMAL-C16. In further aspects, the carrier comprises from about 0.1%
to 10%, 0.5% to 10%, 0.5% to 5%, 1% to 10%, or 1% to 5% of a zwitterionic
surfactant. In particular aspects, the zwitterionic surfactant has a
lipid group having a carbon chain of 13-30 carbon atoms. In further
aspects, the carrier also comprises a pH buffering agent (e.g., phosphate
buffered saline). In certain aspects, the carrier has a pH of between 5.0
and 8.0, between 5.5 and 8.0, between 6.0 and 8.0, between 6.0 and 7.5 or
between 6.1 and 7.4. In still a further aspect, the pharmaceutically
acceptable carrier comprises a liquid and comprises between about
1.times.10.sup.5 and 1.times.10.sup.13, 1.times.10.sup.6 and
1.times.10.sup.13, 1.times.10.sup.7 and 1.times.10.sup.13,
1.times.10.sup.7 and 1.times.10.sup.12, 1.times.10.sup.8 and
1.times.10.sup.12, 1.times.10.sup.9 and 1.times.10.sup.12, or
1.times.10.sup.10 and 1.times.10.sup.13 infectious virus particles (e.g.,
of adenovirus) per ml. In yet further aspects, a composition of the
embodiments is defined as able to retain at least about 10%, 50%, 70%,
80%, 90% or 95% (e.g., 80-95%) of the starting concentration of
infectious virus after storage at room temperature for 2 months, 4
months, 6 months or 8 months.
[0007] In a further embodiment there is provided an immunogenic
composition comprising a recombinant virus vector (e.g., a recombinant
virus vector comprising an expression cassette encoding a heterologous
antigen), said recombinant virus vector formulated in a substantially
solid carrier comprising: (i) PMAL-C16 or (ii) from about 0.1% to 10% of
a zwitterionic surfactant. In some aspects, the substantially solid
carrier comprises less than about 10/o, 5%, 4%, 3%, 2%0, 1%, 0.5% or 0.1%
water. In certain aspects, the substantially solid carrier comprises
PMAL-C16, such as about 0.1 to 50 mg/ml, 1 to 40 mg/ml, 1 to 30 mg/ml, 1
to 20 mg/ml, or 5 to 15 mg/ml (e.g., about 10 mg/ml) of PMAL-C16. In
further aspects, the substantially solid carrier comprises about 0.1% to
10%, 0.5% to 10%, 0.5% to 5.degree. %, 1% to 10%, or 1% to 5% of
PMAL-C16. In further aspects, the substantially solid carrier comprises
from about 0.1% to 10%, 0.5% to 10%, 0.5% to 5%, 1% to 10%, or 1% to 5%
of a zwitterionic surfactant. In particular aspects, the zwitterionic
surfactant has a lipid group having a carbon chain of 13-30 carbon atoms.
In further aspects, the carrier also comprises a pH buffering agent
(e.g., phosphate buffered saline). In certain aspects, the carrier has a
pH of between 5.0 and 8.0, between 5.5 and 8.0, between 6.0 and 8.0,
between 6.0 and 7.5 or between 6.1 and 7.4. In still a further aspect,
the substantially solid carrier comprises a thin film and comprises a
between about 1.times.10.sup.5 and 1.times.10.sup.13, 1.times.10.sup.6
and 1.times.10.sup.13, 1.times.10.sup.7 and 1.times.10.sup.13,
1.times.10.sup.7 and 1.times.10.sup.12, 1.times.10.sup.8 and
1.times.10.sup.12, 1.times.10.sup.9 and 1.times.10.sup.12, or
1.times.10.sup.10 and 1.times.10.sup.13 infectious virus particles (e.g.,
of adenovirus) per cm.sup.3. In yet further aspects, a composition of the
embodiments is defined as able to retain at least about 10%, 50%, 70%,
80%, 90% or 95% (e.g., 80-95%) of the starting concentration of
infectious virus after storage at room temperature for 6 months, 12
months, 24 months or 36 months.
[0008] In still aspects, a composition of the embodiments further
comprises a stabilizing agent, such as a sugar, a polymer, amino acids,
such as glycine and lysine, or a lyoprotectant. In further aspects, the
stabilizing agent comprises a carbohydrate stabilizing agent. For
example, the stabilizing agent can comprise dextrose, mannose, galactose,
fructose, lactose, sucrose, maltose, sorbitol, mannitol, pluronic F68,
melezitose or mixture thereof.
[0009] In some aspects, the recombinant virus vector is a non-enveloped
virus, such as a non-enveloped DNA virus. In further aspects, the
recombinant virus vector is an adenovirus vector, such as a vector
comprising a E1/E3 deletion. In particular aspects, the adenovirus vector
is an adenovirus 5 vector. In yet further aspects the virus is an
enveloped virus (e.g. influenza virus).
[0010] A heterologous antigen according to the embodiments can be any of
variety of antigens, including but not limited to, a cancer cell antigen
or an infectious disease antigen, such as a viral, bacterial or parasite
antigen. In certain aspects, the heterologous antigen is a heterologous
viral polypeptide, such as a viral envelope polypeptide. For example, the
heterologous antigen may be an Ebola virus polypeptide, such as the Ebola
virus glycoprotein. In some further aspects, the expression cassette
encodes a heterologous antigen, which has been codon optimized for
expression in mammalian (e.g., human) cells. Additional exemplary
antigens for use according to the embodiments are detailed below.
[0011] In a further specific embodiment there is provided an immunogenic
composition comprising a recombinant adenovirus vector comprising an
expression cassette encoding a heterologous antigen, said recombinant
virus vector formulated in a substantially solid carrier comprising from
about 0.1% to 10% of a zwitterionic surfactant, said zwitterionic
surfactant having a lipid group with a carbon chain of 13-30 carbon
atoms. In a particular aspect, the antigen is an Ebola virus
glycoprotein.
[0012] In yet a further embodiment, there is provided a method for
providing an immune response in a mammal comprising obtaining a
composition in accordance with the embodiments and aspects described
above, which has been dispersed in a pharmaceutically acceptable liquid,
and administering an effective amount of the dispersed composition to a
mammal. In certain aspects, such a method comprises obtaining a
composition in a substantially solid carrier and dispersing the
composition in a pharmaceutically acceptable liquid (e.g., water). In
some aspects, the administering comprises administering the dispersed
composition to a mucosal tissue of the mammal. In certain aspects, the
administering is by oral, sublingual, buccal or intranasal
administration. In particular aspects, the pharmaceutically acceptable
liquid is water or saline solution. In certain aspects, obtaining the
composition comprises solubilizing the solid composition in an aqueous
liquid such as by contacting the solid with the aqueous liquid and
incubating the solid and aqueous liquid for certain period of time, e.g.,
1 to 15 minutes.
[0013] In yet a further embodiment there is provided a method for
providing an immune response in a mammal comprising obtaining a
composition a recombinant virus vector (e.g., an adenovirus vector) in a
pharmaceutically acceptable carrier, said carrier comprising: (i)
PMAL-C16 or (ii) from about 0.1% to 10% of a zwitterionic surfactant, and
administering an effective amount to the composition to a subject,
wherein the subject has been previously exposed to a virus that cross
reacts antigenically with the virus vector of the composition. Thus, in
some cases, a subject for treatment according to the embodiments
comprises antibodies (e.g., neutralizing antibodies) that bind to the
recombinant virus vector. In certain specific aspects, the virus vector
is an adenovirus 5 vector and the subject has been previously exposed to
adenovirus 5. In further aspects, the virus (e.g., virus vector) of the
composition is an influenza virus and the subject has been previously
exposed to influenza virus. In a further embodiment there is a provided a
method for protecting a viral vector from a pre-existing immune response
in a subject comprising formulating the viral vector with an effective
amount of a zwitterionic surfactant (e.g., PMAL-C16) and administering
the formulated viral vector to the subject.
[0014] In yet still a further embodiment there is provided a method of
making a stabilized immunogenic composition comprising formulating a
solution comprising a recombinant virus vector (e.g., an adenovirus
vector) in a pharmaceutically acceptable carrier, said carrier
comprising: (i) PMAL-C16 or (ii) from about 0.1% to 10% of a zwitterionic
surfactant, and then drying the solution to provide a stabilized
immunogenic composition. In certain aspects, drying the solution
comprises dispersing the solution in a thin film and allowing the liquid
to evaporate. In further aspects, the method additionally comprises
aliquoting an amount of the stabilized immunogenic composition into a
container.
[0015] In some aspects, prior to drying, the solution comprises about 0.1
to 50 mg/ml, 1 to 40 mg/ml, 1 to 30 mg/ml, 1 to 20 mg/ml, or 1 to 10
mg/ml of the zwitterionic surfactant. In other aspects, prior to drying,
the solution comprises about 0.1 to 50 mg/ml, 1 to 40 mg/ml, 1 to 30
mg/ml, 1 to 20 mg/ml, or 1 to 10 mg/ml of PMAL-C16.
[0016] The present disclosure generally relates to vaccine compositions
that may be administered to a subject via the buccal and/or sublingual
mucosa. In some embodiments, the present disclosure also relates to
methods for administration and preparation of such vaccine compositions.
[0017] In one embodiment, the present disclosure provides a composition
comprising an antigen dispersed within an amorphous solid.
[0018] In another embodiment, the present disclosure provides a method
comprising administering a vaccine composition comprising an antigen
dispersed within an amorphous solid to the buccal and/or sublingual
mucosa of a subject in an amount effective to induce an immune response
to the antigen.
[0019] In yet another embodiment, the present disclosure provides a method
comprising providing an antigen and a solution comprising a sugar; sugar
derivative or a combination thereof, dispersing the antigen within the
solution to form a mixture; and allowing the mixture to harden so as to
form an amorphous solid.
[0020] The features and advantages of the present invention will be
apparent to those skilled in the art. While numerous changes may be made
by those skilled in the art, such changes are within the spirit of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Some specific example embodiments of the disclosure may be
understood by referring, in part, to the following description and the
accompanying drawings. The patent or application file contains at least
one drawing executed in color. Copies of this patent or patent
application publication with color drawing(s) will be provided by the
Office upon request and payment of the necessary fee.
[0022] FIGS. 1A-1C: Multi-Component Formulations Improve Adenovirus
Transduction Efficiency and Stabilize Virus in PLGA Microspheres. (1A)
Transduction Efficiency of Excipients and Formulations in Differentiated
Calu-3 Cells. Cell monolayers were exposed to formulations containing a
model recombinant adenovirus serotype 5 vector expressing
beta-galactosidase (AdlacZ) for 2 hours at 37.degree. C. Transduction
efficiency was determined by comparison of the number of cells expressing
the beta-galactosidase transgene after treatment with formulated virus to
the number of beta-galactosidase positive cells after treatment with
virus in saline. Results are reported as the mean.+-.standard error of
the mean of data generated from triplicate samples over three separate
experiments (n=9 each formulation). PF68, Pluronic F68; nDMPS,
N-dodecyl-.beta.-D-maltopyranoside; F3, formulation containing sucrose
(10 mg/ml), mannitol (40 mg/ml) and 1% (v/v) poly(ethylene) glycol 3,000.
*indicates a significant difference with respect to unformulated virus
(1B) Adenovirus Concentration Versus Time Profiles of Supernatants
Collected from PLGA Microspheres Stored at 37.degree. C. Ten milligrams
of microspheres containing AdlacZ were suspended in 0.5 ml of sterile
saline immediately after preparation (Immediate Release) or after storage
at room temperature (25.degree. C.) for 7 or 30 days. The number of
infectious particles released at each time point was determined by serial
dilution of collected supernatants and subsequent infection of Calu-3
cells. (1C) In Vitro Release Profiles of Adenovirus from PLGA
Microspheres Stored at Room Temperature Over Time. Release rates for
freshly prepared beads did not significantly differ from those of beads
stored at 25.degree. C. for 7 days. The release rate increased threefold
after storage for one month under the same conditions. Results depicted
in Panels B and C are reported as the mean.+-.standard error of the mean
of data generated from triplicate samples collected from six separate
experiments.
[0023] FIGS. 2A-2H: Formulations Improve Adenovirus Transduction
Efficiency in the Lungs of Naive Mice and Those with Prior Exposure to
Adenovirus. Naive C57BL/6 mice were given 5.times.10.sup.10 particles of
the model recombinant virus used for in vitro screening of formulations
(AdlacZ) suspended in potassium phosphate buffered saline (2A), in
formulation F3 (2B), PEGylated virus (2C) or 4.6 mg of PLGA microspheres
containing the same dose of virus (2D) by the intranasal route. A second
set of mice were divided into the same treatment groups 28 days after
receiving a dose of 5.times.10.sup.10 particles of AdNull, an E1/E3
deleted recombinant adenovirus serotype 5 virus similar to the AdlacZ
vector which does not contain a transgene cassette (2E-2H). Mice in each
group were sacrificed 4 days after administration of the AdlacZ vector.
Images display representative gene expression patterns for 6 mice per
treatment group. Magnification in each panel: 200.times..
[0024] FIGS. 3A-3E. Formulated Preparations Maintain Antigen Specific
Poly-Functional T Cell Responses in Naive Mice and Those with Prior
Exposure to Adenovirus. Characterization of the immune response to Ebola
glycoprotein was performed in B10.Br mice as described previously (Patel
et al., 2007; Croyle et al., 2008; Choi et al., 2012; Choi et al., 2013).
(3A) Magnitude of the Systemic CD8+ T Cell Response Against Ebola
Glycoprotein. The number of IFN-.gamma. secreting mononuclear cells was
quantitated in isolates taken 10 days after immunization from the spleen
of naive B10.Br mice and those with prior-exposure to adenovirus by
ELISpot. (3B) Magnitude of the Mucosal CD8+ T Cell Response Against Ebola
Glycoprotein. The number of IFN-.gamma. secreting mononuclear cells was
quantitated 10 days after immunization in bronchioalveolar lavage (BAL)
fluid of naive mice and those with prior-exposure to adenovirus by
ELISpot. (3C) Polyfunctionality of the Ebola Glycoprotein-specific T Cell
Response in Naive mice. Ten days after immunization, splenocytes from 5
mice per treatment group were pooled and stimulated with an Ebola
glycoprotein-specific peptide. Bar graphs illustrate the percentage of
CD8.sup.+ tumor necrosis factor .alpha. (TNF-.alpha.)-, interleukin 2
(IL-2)- and interferon .gamma. (IFN-.gamma.)-producing cells detected
after 5 hours of antigen stimulation. Distribution of single-, double-
and triple-cytokine-producing CD8.sup.+ T cells is shown as various
colors in pie chart diagrams. The relative frequency of cells that
produce all three cytokines defines the quality of the vaccine-induced
CD8+ T cell response. The proportion of these cells
(IFN-.gamma..sup.+IL-2.sup.+ TNF-.alpha..sup.+) generated in response to
each treatment is written in the red section of each pie chart while the
proportion of cells producing a single cytokine are represented by the
light blue, purple and yellow sections of each pie chart. (3D)
Polyfunctionality of the Ebola Glycoprotein-Specific T Cell Response in
Mice with Prior Exposure to Adenovirus. Pre-existing immunity to
adenovirus 5 was induced by instilling 5.times.10.sup.10 virus particles
of AdNull, an E1/E3 deleted virus that does not contain a transgene
cassette, in the nasal cavity of mice 28 days prior to immunization. Ten
days after immunization, splenocytes were harvested and pooled as
described in 3C. An increase in the number of polyfunctional cells, as
indicated by an increase in the size of the red section of each pie
graph, was fostered by several of the test formulations with respect to
that produced by unformulated vaccine. (3E) Quantitative Analysis of the
Effector Memory T Cell Response. Splenocytes were harvested 42 days after
immunization, stained with CFSE and stimulated with the TELRTFSI peptide
for 5 days. Cells positive for CD8+, CD44.sup.HI and CD62L.sup.LOW
markers were then evaluated for CFSE by four-color flow cytometry. Data
represent the average values obtained from three separate experiments
each containing 5 mice per treatment. Error bars reflect the standard
error of the data. *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA,
Bonferroni/Dunn post-hoc analysis.
[0025] FIGS. 4A-4B: Formulated Vaccines Improve the Anti-Ebola
Glycoprotein Antibody Response. Serum collected from individual mice 42
days after immunization was screened for total IgG and IgG isotypes by
ELISA. (4A) Antibody Profile for Naive Mice. Naive B10.Br mice were given
1.times.10.sup.8 particles of Ad-CAGoptZGP suspended in formulation or
4.6 mg of PLGA microspheres containing the virus in KPBS by the
intranasal route. (4B) Antibody Profile for Mice with Pre-Existing
Immunity to Adenovirus. Pre-existing immunity was established by
instillation of a dose of 5.times.10.sup.10 particles of AdNull in the
nasal passages of B10.Br mice 28 days prior to immunization with
formulated vaccines. In both panels, the average optical density read
from samples obtained from each treatment group are presented to serve as
a measure of relative antibody concentration and data reported as average
values.+-.the standard error of the mean obtained from three separate
experiments each containing 5 mice per treatment. In each panel, the
asterisk indicates a significant difference with respect to naive,
immunized animals. *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA,
Bonferroni/Dunn post-hoc analysis.
[0026] FIGS. 5A-5C: Formulations that Augment Both the Polyfunctional T
cell Response and Antigen-Specific IgG1 Antibody Levels in Mice with
Prior Exposure to Adenovirus Improve Survival from Lethal Challenge.
Naive B10.Br mice were given 1.times.10.sup.8 particles of Ad-CAGoptZGP
suspended in formulation or 4.6 mg of PLGA microspheres containing the
virus in KPBS by the intranasal route. Pre-existing immunity (PEI) was
established by instillation of a dose of 5.times.10.sup.10 particles of
AdNull in the nasal passages of B10.Br mice 28 days prior to
immunization. Twenty eight days after immunization, mice (n=10/group)
were challenged with a lethal dose of 1,000 pfu mouse-adapted Ebola
(30,000.times.LD.sub.50) by intraperitoneal injection. (5A) Kaplan-Meier
survival curve. * indicates a significant difference with respect to the
PEI/Unformulated treatment group. (5B) Body weight profile after
challenge. No significant changes in body weight were noted in animals
that survived challenge. The most significant drop in weight (.about.15%
reduction) was observed in animals with prior exposure to adenovirus
immunized with the PEGylated preparation. (5C) Serum alanine (ALT) and
aspartate (AST) aminotransferase levels post-challenge. Samples from
non-survivors were taken at time of death. Samples from survivors were
taken 14 days post-challenge. In all panels, *p<0.05, **p<0.01,
***p<0.001, one-way ANOVA, Bonferroni/Dunn post-hoc analysis.
[0027] FIG. 6A-6D: Poly Maleic Anhydrides: Amphiphilic Compounds That
Improve Adenovirus Transduction Efficiency with Minimal Toxicity. A
series of zwitterionic polymers of varying size were screened for their
ability to improve the transduction efficiency of recombinant
adenoviruses in lung epithelial cells. Initial screening of formulations
in vitro and in vivo was performed with AdlacZ containing the
beta-galactosidase transgene (6A and 6D). Use of an E1/E3 deleted
recombinant adenovirus expressing green fluorescent protein (AdGFP) and
quantitation of infected cells by flow cytometry enhanced sensitivity of
the screening assay so that subtle differences in transduction efficiency
in the presence of anti-adenovirus neutralizing antibodies could be
detected (6C). (6A) Transduction Efficiency of Formulated AdlacZ In the
Presence of Neutralizing Antibody. Formulations containing
1.times.10.sup.8 infectious particles of AdlacZ were incubated with
aliquots of a highly characterized neutralizing antibody stock for 1 hour
prior to infection of Calu-3 cells. Forty-eight hours later,
beta-galactosidase positive cells were identified by histochemical
staining. The number of infectious virus particles was tallied and
calculated as described previously (Callahan et al., 2008). (6B) Toxicity
Profile of F16. Formulations were placed on differentiated Calu-3 cell
monolayers for a period of 2 hours. Culture media was then assessed for
LDH activity. Lysis buffer served as a positive control (100% lysis) and
KPBS as a negative control. (6C) Quantitative Assessment of Transduction
Efficiency of Formulated AdGFP Over a Range of Neutralizing Antibody
Concentrations. In this experiment, 1.times.10.sup.8 infectious particles
of AdGFP were incubated in solution containing concentrations of
anti-adenovirus antibody reflective of that found in the global
population (Barouch et al., 2011; Choi et al., 2012) as described in
Panel A. Twenty-four hours after infection, infected cells, positive for
GFP, were counted by flow cytometry. (6D) Histological Evaluation of
Transgene Expression in the Lung 4 Days After Intranasal Administration
of Formulated Virus. A single dose of 5.times.10.sup.10 infectious
particles of AdlacZ was given to naive mice or mice with PEI to
adenovirus induced by the intranasal route. Four days later, mice were
sacrificed, tissue harvested and stained for transgene expression.
Sections illustrate representative transgene expression patterns found in
tissue collected from 6 animals per treatment. Magnification for
Unformulated panels: 200.times.. Magnification for F16 panels:
400.times.. Results in FIGS. 6A-6C are reported as the mean.+-.standard
error of the mean of data generated from triplicate samples collected
from four separate experiments.
[0028] FIGS. 7A-7C: Formulation F16 Improves Quantitative and Qualitative
Ebola Glycoprotein-Specific CD8.sup.+ T Cell Responses in Mice with Prior
Exposure to Adenovirus. PEI to adenovirus 5 was induced by instilling
5.times.10.sup.10 virus particles of AdNull, an E1/E3 deleted virus that
does not contain a transgene cassette, in the nasal cavity of mice 28
days prior to immunization. (7A) The Systemic Effector CD8.sup.+ T Cell
Response. Ten days after vaccination, mononuclear cells from the spleen
were harvested, stimulated with an Ebola GP-specific peptide and
responsive cells quantitated by ELISpot. (7B) The Mucosal Effector
CD8.sup.+ T Cell Response. Ten days after vaccination, mononuclear cells
collected from BAL fluid were harvested, pooled according to treatment,
stimulated with an Ebola GP-specific peptide and responsive cells
quantitated by ELISpot. (7C) The Polyfunctional CD8.sup.+ T Cell
Response. Ten days after immunization, splenocytes from 5 mice per
treatment group were pooled and stimulated with an Ebola
glycoprotein-specific peptide. Each positively responding cell was
assigned to one of 7 possible combinations of IFN-.gamma., IL-2 and
TNF-.alpha. production and quantitated as shown in the bar graph. The
most potent responders, those producing all 3 cytokines in response to
stimulation, are depicted by the red arcs in the pie charts. The
proportion of cells in samples from each treatment group that produce
IFN-.gamma. is depicted by the blue arc. The number in each pie chart
denotes the percentage of triple producers found in samples from a given
treatment group. Data reflect average values.+-.the standard error of the
mean for six mice per group. *indicates a significant difference with
respect to the Naive/unformulated group, *p<0.05, **p<0.01, one-way
ANOVA, Bonferroni/Dunn post-hoc analysis.
[0029] FIG. 8. Formulation F16 Improves the Antigen Specific Antibody
Response in Mice with Prior Exposure to Adenovirus. The average optical
density read from individual samples obtained from each treatment group
are presented to serve as a measure of relative antibody concentration
and data reported as average values.+-.the standard error of the mean
obtained from two separate experiments each containing 6 mice per
treatment. The limit of detection for the assay is 0.01 absorbance unit.
**p<0.01, one-way ANOVA, Bonferroni/Dunn post-hoc analysis.
[0030] FIG. 9. Schematic illustration of vaccination process for liquid
formulations and/or those reconstituted from a solid matrix. The sedate
animal's head was rested upon an empty tuberculin syringe to keep the
head in an upright position and to minimize choking or accidental
swallowing of vaccine.
[0031] FIG. 10: Timeline and sampling schedule for primate Study 1.
Animals were screened for signs of prior exposure to adenovirus (anti-Ad5
NAB, Ad5 DNA, T cell responses) 4 days prior to immunization. Baseline
blood chemistry panels were also evaluated at this time. Samples were
taken for evaluation of blood chemistry and adenovirus shedding (nasal
and oral swabs, urine, feces) 6 h after immunization and on days 1, 2,
and 7. On day 20, serum and BAL were collected for assessment of shedding
and anti-Ad5 NAB and anti-Ebola GP antibody levels. BAL, PBMCs, and ILNs
were also screened for Ebola GP-specific CD8+ and CD4+ T cells at this
time point. On day 38, additional samples were taken for assessment of
anti-Ebola GP and anti-Ad5 antibodies and antigen-specific T cell
proliferation (Ebola GP and Ad5). 42 days after immunization, NHPs were
shipped to the National Microbiology Laboratory in Winnipeg, Canada, for
challenge. After an acclimation period, primates were challenged with
1,000 pfu of Ebola (1995, Kikwit) by intramuscular (IM) injection.
[0032] FIGS. 11A-11D: Primate Study 1: Clinical parameters evaluated over
time in non-human primates immunized by various routes. Cynomolgus
macaques were given a single dose of vaccine by IM injection or by the
respiratory or the SL route. Each line represents alterations for each
parameter during the course of therapy for one primate. In each panel:
Red lines/squares: saline control. Green lines/circles: IM injection.
Blue lines/triangles: IN/IT immunization. Orange lines/diamonds: SL
immunization.
[0033] FIGS. 12A-12F: Primate Study 1: Adenovirus genomes are released
predominantly in the nasal mucosa and feces after respiratory
immunization and in the oral and nasal mucosa after sublingual
immunization. Male cynomolgus macaques were given either 1.times.10.sup.9
ivp by IM injection or 1.times.10.sup.10 ivp by the respiratory or the SL
route. DNA was isolated from each sample, and viral genomes were
determined by real time PCR. Animal numbers and corresponding treatments
are outlined in Table 1.
[0034] FIGS. 13A-13F: Primate Study 1: Respiratory immunization induces
strong antigen-specific T cell responses after administration of a single
dose of a formulated adenovirus-based Ebola vaccine. (13A) Quantitative
analysis of Ebola glycoprotein-specific CD4.sup.+ T cells in BAL fluid.
Cells were isolated from whole blood 20 days after immunization and
stimulated with a peptide library for Ebola glycoprotein or peptides
specific for the MHC class II associated invariant chain peptide that
binds the MHC class II groove of cells (h-Clip, negative control).
Positive control cells were stimulated with PMA and ionomycin. Each cell
population was stimulated for 5 h, stained for phenotypic markers, and
analyzed by flow cytometry. (13B) Quantitative analysis of Ebola
glycoprotein-specific CD8.sup.+ T cells in BAL fluid. Cells were treated
as described for 13A. (13C) Magnitude of the antigen-specific response of
mononuclear cells isolated from whole blood of macaques. PBMCs were
isolated 20 days after immunization from whole blood and evaluated for
IFN-.gamma. secretion after stimulation with an Ebola GP-specific peptide
library by ELISpot. (13D) Magnitude of the antigen-specific response in
mononuclear cells isolated from iliac lymph nodes (ILNs) of primates.
MNCs were isolated 20 days after immunization from ILNs and evaluated for
IFN-.gamma. secretion after stimulation with an Ebola GP-specific peptide
library by ELISpot. (13E) Proliferative capacity of Ebola GP-specific T
cells collected 38 days after immunization of naive primates by various
routes. The proliferative capacity of CD4.sup.+ (white bars) and
CD8.sup.+ (black bars) T cells isolated from whole blood was evaluated
for each animal by stimulation for 5 days with an Ebola GP-specific
peptide library and subsequent staining for Ki-67, an intracellular
marker for proliferation (Gerdes et al., 1983). (13F) Proliferative
capacity of adenovirus serotype 5-specific T cells after immunization by
various routes. Cells were isolated from whole blood 38 days after
immunization and stimulated for 5 days with a first generation adenovirus
that does not contain a transgene cassette (AdNull, MOI 1:1,000). The
proliferative capacity of CD4.sub.+ (white bars) and CD8.sub.+ (black
bars) T cells was determined by intracellular staining for Ki-67. Animal
numbers displayed in each panel and their corresponding treatments are
summarized in Table 1.
[0035] FIGS. 14A-14C: Primate Study 1: Respiratory immunization induces
strong anti-Ebola GP and minimal anti-adenovirus antibody responses in
serum and BAL fluid. Serum (14A) was collected 20 and 38 days after
immunization. BAL fluid (14B) was collected 20 days after immunization.
These samples were screened for the presence of anti-Ebola GP antibodies
by ELISA. Serum collected on day 20 was also screened for anti-adenovirus
5 NABs using an infectious titer assay (14C). Data in 14C is reported as
the dilution at which the infectious titer of a first generation
adenovirus expressing the beta-galactosidase transgene was reduced by
50%. In each panel, error bars represent the standard error of samples
assayed in triplicate from each primate for each time point.
[0036] FIGS. 15A-15H: Respiratory immunization confers long-term immunity
to Ebola in naive NHPs. Naive male cynomolgus macaques (see Table 1 for
characteristics) were challenged 62 days after immunization with a lethal
dose of 1,000 pfu (1,000 TCID.sub.50) of Ebola virus (1995, Kikwit).
(15A) Kaplan-Meier survival curve. (15B) Body weight profile after
challenge. (15C) Thermal analysis of animals during challenge. (15D)
Daily clinical scores for each primate using a standard, approved scoring
methodology throughout the challenge. Variations in serum (15E) alanine
aminotransferase (ALT), (15F) alkaline phosphatase (ALP), (15G) blood
urea nitrogen (BUN), and (15H) platelets (PLT) were noted in animals that
did not survive challenge. Red line: saline control. Green lines: IM
injection. Blue lines: IN/IT immunization. Orange lines: SL immunization.
[0037] FIGS. 16A-16B: Primate Study 2. (16A) Immunization schedule. Eleven
male cynomolgus macaques of Chinese origin were immunized according to
the schedule depicted in the figure. Animals were shipped to the National
Microbiology Laboratory (NML) in Winnipeg 126 days after immunization for
challenge on day 150 of the study. (16B) Sample collection scheme for
Study 2. Animals were screened for signs of prior exposure to adenovirus
and Ebola (anti-Ad5 NAB, Ad5 DNA, anti-Ebola GP antibodies) 1 week prior
to the initiation of the study. Baseline blood chemistry panels were also
evaluated. Samples were taken for evaluation of blood chemistry and
adenovirus shedding (nasal, oral, rectal swabs, urine, feces) 6 h after
immunization as well as on days 1, 2, and 7. On day 20, serum and BAL
were collected for assessment of shedding, anti-Ad5 NABs, and anti-Ebola
GP antibodies. On day 42, additional samples were taken for assessment of
anti-Ebola GP and anti-Ad5 antibodies and antigen-specific T cell
proliferation (Ebola GP and Ad5). 150 days after immunization, NHPs were
shipped to the National Microbiology Laboratory in Winnipeg for
challenge. IN/IT: intranasal/intratracheal. IM: intramuscular. SL:
sublingual. PEI, pre-existing immunity.
[0038] FIGS. 17A-17D: Primate Study 2: Clinical parameters demonstrating
transient changes after immunization of naive non-human primates and
those with pre-existing immunity to adenovirus immunized by various
routes. Naive cynomolgus macaques were given a single dose of vaccine by
the respiratory (IN/IT) or the SL routes. A separate group of animals
first received a dose of an adenovirus serotype 5 host range mutant virus
42 days prior to immunization. Each line represents alterations for each
parameter after immunization for one individual primate. Blue
lines/triangles: IN/IT immunization. Black lines/squares: SL immunization
(primates with pre-existing immunity to adenovirus). Orange
lines/diamonds: SL immunization (naive primates).
[0039] FIGS. 18A-18F: Primate Study 2: Adenovirus genomes are released in
the serum and nasal mucosa after IN/IT administration of formulated
vaccine and in the oral mucosa after sublingual immunization. Male
cynomolgus macaques were given either 1.6.times.10.sup.9 ivp/kg of
vaccine in a formulation of 10 mg/mL poly(maleic
anhydride-alt-1-octadecene) substituted with 3-(dimethylamino)propylamine
by the respiratory route or 2.times.10.sup.10 ivp/kg of vaccine in
potassium phosphate buffered saline by the SL route. DNA was isolated
from each sample, and viral genomes were determined by real time PCR.
Animal numbers and corresponding treatments are outlined in Table 2.
[0040] FIGS. 19A-19D: Primate Study 2: Mucosal immunization elicits
diverse populations of T cells capable of responding to Ebola
glycoprotein 150 days after treatment. Quantitative analysis of CD4.sup.+
T cell populations secreting individual and combinations of cytokines in
response to antigen stimulation after IN/IT administration (19A), SL
administration to naive animals (19C), and SL administration to those
with pre-existing immunity to adenovirus (19D). 19B reflects the
quantitative analysis of CD8.sup.+ T cell populations after immunization
by the IN/IT route. Each positively responding cell was assigned to one
of 8 possible categories reflecting the production of IFN-.gamma., IL-2,
and IL-4 alone or in combination. Pie charts depict the variety of T cell
populations found in each individual animal. CD4.sup.+ T cells were not
found in samples obtained from primate 808233 (SL immunization). A single
CD8.sup.+ IL-2.sup.+ population was detected in samples from primate
804819 (PEI-SL) and is not illustrated as a pie chart.
[0041] FIGS. 20A-20F: Primate Study 2: Respiratory immunization induces
production of antigen-specific antibodies that are sustained over time.
Serum was collected from cynomolgus macaques immunized by the IN route
(20A) on days 20, 104, and 142 after immunization and analyzed for
anti-Ebola GP IgG by ELISA as described (Choi et al., 2013). Serum was
also collected from naive primates (20C) and those with pre-existing
immunity to adenovirus (20D) on days 20 and 57 after immunization. These
samples along with BAL fluid (20B) collected from all primates were
screened for anti-Ebola GP antibodies in the same manner. Serum from
animals immunized by the IN/IT route (20E) and from animals immunized by
the SL route (20F) was also screened for anti-adenovirus neutralizing
antibodies. In each panel, error bars represent the standard error of
samples assayed in triplicate from each primate for each time point.
[0042] FIGS. 21A-21I: Primate Study 2: A single dose of a formulated
adenovirus-based vaccine protects from lethal challenge 150 days after
immunization. (21A) Kaplan-Meier survival curve. Cynomolgus macaques were
given a single dose of 1.4.times.10.sup.9 ivp of Ad-CAGoptZGP in a
formulation containing sucrose (10 mg/ml), mannitol (40 mg/ml) and mg/mL
poly(maleic anhydride-alt-1-octadecene) substituted with
3-(dimethylamino)propylamine, in phosphate buffered saline. Every animal
immunized with this preparation survived lethal challenge. (21B) Body
weight profiles of immunized animals challenged with Ebola. Animals
succumbing to infection experienced a change of +10% of body weight
during the active infection period. (21C) Body temperature of primates
during challenge. Body temperature declined in each animal during
challenge with the most dramatic drops observed in animals that were not
protected from infection. (21D) Clinical scores. Primates were observed
on a daily basis during the challenge period. Clinical scores were
recorded for each primate by a blinded technician using a standard,
approved scoring methodology. (21E) Lymphocyte profiles. Lymphocytes of
surviving animals recovered from an initial drop 3 days after challenge
and remained stable throughout the remainder of the study. (21F) ELISpot
analysis of the cellular immune response in surviving animals 14 days
after challenge. PBMCs were isolated from whole blood and stimulated with
a peptide pool spanning the Ebola glycoprotein. (21G) Platelet counts of
primates during challenge. A notable drop in platelets was observed in
all animals during challenge. (21H) Serum alanine aminotransferase (ALT)
levels during challenge. Samples were collected from animals on day 3 and
day 14 and at the time of death. (21I) Blood urea nitrogen (BUN) profile
of immunized animals during challenge. This parameter remained unchanged
in immunized animals that survived challenge. Red lines/circles: saline
controls. Blue lines/triangles: IN/IT immunization. Orange
lines/diamonds: SL immunization. Black lines/squares: animals with
pre-existing immunity to adenovirus immunized by the SL route.
[0043] FIGS. 22A-22F: Anti-Ebola GP antibodies generated by a formulated
adenovirus-based respiratory vaccine are neutralizing while those
produced by an unformulated sublingual vaccine are partially
neutralizing. The neutralizing capacity of antibodies in serum collected
from each primate was assessed using a fluorescence neutralization assay
(FIGS. 22A, 22C, and 22E). The amount of Ebola virus present in the serum
of animals during challenge was determined using a standard infectious
titer assay (FIGS. 22B, 22D, and 22F). In each panel, data obtained from
animals given saline prior to challenge with Ebola are included as red
symbols and lines for reference. TCID.sub.50=median tissue culture
infectious dose 50 or the amount of virus that will produce pathological
change in 50% of cells that are infected in culture. These assays were
performed under BSL-4 conditions at the National Microbiology Laboratory
in Winnipeg.
[0044] FIGS. 23A-23B: Biologicals can be stabilized in small, unit dose
films for evaluation of potency and bioavailability of protein based,
live virus and bacteria-based vaccines in a variety of animal models and
for evaluation of long-term physical stability of vaccines (23A). Several
thousand doses of a given biological substance can be stabilized in large
films that can be divided into reproducible single-use pieces (23B).
[0045] FIGS. 24A-24D: (24A) Porous surface of dried film (3% HPMC/2%
sorbitol/0.2% tragacanth gum/PBS) in the absence of virus (Magnification:
75,000.times.). (24B) Electron micrograph of dried film (1.5% HPMC/2%
Sorbitol/0.2% tragacanth gum/PBS) in the absence of virus (Magnification:
25,000.times.). (24C) Large Non-Crystalline Pockets in Film made of 1.5%
HPMC/2% Sorbitol/0.2% tragacanth gum in PBS which Foster Stabilization of
Virus Particles in the Amorphous State. (Magnification 20,000.times.).
(24D) Adenovirus Particles (arrows) Suspended in Film. The presence of
the virus notably changes the physical characteristics of the film as it
assumes a non-porous, amorphous shape. Formulation is same as that in
24C. (Magnification 20,000.times.).
[0046] FIG. 25: Films Retain 3 Dimensional Shape of Embedded Virus After
12 months of Storage at Room Temperature. Virus particles (70 nm, shaded
areas, arrows) embedded in film (Formulation 2 in FIG. 2) and stored in
the dry state for one year. Film was embedded in epoxy resin, sectioned
frozen and transferred directly to the electron microscope under osmium
vapor. (Magnification 20,000.times.).
[0047] FIG. 26: Infectious Enveloped and Non-Enveloped Viruses Can Be
Recovered from Dried Film. Infectious titers of recombinant adenovirus
expressing the Ebola Virus glycoprotein (a non-enveloped virus) and PR8
(HIN1 influenza) were evaluated in liquid formulations, dried and
reconstituted 48 hours after storage in the dry state at 20.degree. C.
Data is recorded as the difference in titers of each preparation prior to
drying and after reconstitution.
[0048] FIG. 27: Solvent System Influences Changes in Film pH During the
Drying Process. The pH of each formulation in the liquid (pre-dry) and
dry state was recorded according to the method described in Croyle et al.
(2001) Gene Ther. 8: 1281-1290. Prior to drying, 10 microliters of
Universal pH Indicator Solution (Fisher Scientific) was added to each
formulation and the pH visually recorded. When drying was complete, films
were visually inspected and the pH compared to pre-drying values. On the
x-axis, 1 is distilled, deionized water, 2 is 120 mM PBS (phosphate
buffered saline), and 3 is 10 mM Tris (Tris(hydroxymethyl)aminomethane).
Formulations evaluated in this study consisted of 0.1-15% hydroxypropyl
methylcellulose, 0.1-0.8% tragacanth gum, 1-5% sorbitol and 1-100 mg/ml
melezitose.
[0049] FIGS. 28A-28C: Solvent System Dictates Recovery of Virus from Dried
Film. Three different aqueous solvent systems were utilized in
formulations containing: Low (Base 1, 0.5%) (28A), Medium (Base 2, 1.5%)
(28B), and High (Base 3, 3%) (28C) concentrations of hydroxypropyl
methylcellulose, (Base in figure). Films were dried at ambient
temperature and pressure for 5 hours. Twenty four hours later, each film
was reconstituted with sterile saline and infectious titer of virus
embedded in the preparation determined by serial dilution, infection of
HeLa cells and visual tallying of cells staining positive for virus.
Percent recovery was calculated using the following formula:
% Recovery = log ( infectious Titer at
t = 1 ) log ( ( Infectious Titer at t =
0 ) .times. 100 ##EQU00001##
[0050] FIG. 29: The pH of the Dried Film Significantly Impacts Recovery of
Infectious Virus After Reconstitution. Recombinant adenovirus was placed
in a variety of formulations that were dried as thin films. Twenty-four
hours later, films were reconstituted and viral titer assessed by a
standard limiting dilution assay. Data was grouped according to the final
pH of the dried film. (correlation coefficient r.sup.2=0.996)
[0051] FIG. 30: Detergent Prevents Drop in Film pH After Drying. The pH of
formulations consisting of 0.1-15% hydroxypropyl methylcellulose,
0.1-0.8% tragacanth gum, 1-5% sorbitol and 1-100 mg/ml melezitose.
without detergent (BASE) and that containing 10 mg/ml PMCAL C16
(BASE+DET) in the liquid (pre-dry) and dry state was recorded according
to the method described in Croyle et al. (2001) Gene Ther. 8: 1281-1290.
Prior to drying, 10 microliters of Universal pH Indicator Solution
(Fisher Scientific) was added to each formulation and the pH visually
recorded. When drying was complete, films were visually inspected and the
pH compared to pre-drying values.
[0052] FIGS. 31A-31B: Formulation Dictates Recovery of Virus from Dried
Film in Certain Solvent Systems. Three different concentrations of
hydroxypropyl methylcellulose (0.5, 1.5 and 3%) were evaluated for their
ability to retain infectious titer of virus after drying in 120 mM PBS
(Solvent 2) or 10 mM Tris buffer. Films were dried at ambient temperature
and pressure for 6 hours. Twenty four hours later, each film was
reconstituted with sterile saline and infectious titer of virus embedded
in the preparation determined by serial dilution, infection of HeLa cells
and visual tallying of cells staining positive for virus. Percent
recovery was calculated using formula provided above.
[0053] FIG. 32: Detergent Significantly Improves Recovery of Infectious
Virus from Films. Recombinant adenovirus (1.25.times.10.sup.12 particles)
was formulated in: (A) 0.5% w/w hydroxypropyl methylcellulose containing
2% w/w sorbitol (Formulation 1) or 2% v/v glycerol (Formulation 2); (B)
1.5% w/w hydroxypropyl methylcellulose containing 2% w/w sorbitol
(Formulation 3) or 2% v/v glycerol (Formulation 4); (C) 3% w/w
hydroxypropyl methylcellulose containing 2% w/w sorbitol (Formulation 5)
or 2% v/v glycerol (Formulation 6) with (+ DET) or without (- DET) 10
mg/ml PMAL C16. Formulations were dried into thin films, reconstituted 24
hours after drying and infectious titer determined by limiting dilution
on HeLa cells.
[0054] FIG. 33: The Amount of Virus Embedded in Film Formulation Does not
Impact Recovery. Adenovirus particles were incorporated in thin films in
amounts ranging from those found post-purification (1.times.10.sup.13,
1.times.10.sup.12 infectious particles) to those which reflect reasonable
doses for immunization and therapeutic purposes
(1.times.10.sup.11-1.times.10.sup.7 infectious particles). These
concentrations did not seem to impact recovery from dried films
suggesting that they can be utilized for stabilizing biologicals during
holding steps of manufacturing processes as well as for single use films
for self therapy/immunization.
[0055] FIG. 34: Binding Agents Improve Recovery of Recombinant Virus from
Film. Inclusion of a binding agent (in this case 2% w/w sorbitol, Binder)
in the film formulation improved recovery of virus by 43% (1.5% HPMC,
Base 2) and 21.1% (3% HPMC, Base 3) after drying. Addition of
plasticizers (in this case 2% v/v glycerol, Plasticizer) did not improve
recovery to the same degree (32.3%, Base 2, 14.1%, Base 3).
[0056] FIG. 35: Virus Significantly Impacts the Dissolution Rate of Films
in Simulated Saliva. Films of uniform weight containing
1.25.times.10.sup.12 particles of recombinant adenovirus (VIRUS) and
blank controls were placed in simulated human salivary fluid at
37.degree. C. under gentle stirring. Dissolution rate was calculated by
dividing the starting weight of the film by the time at which the film
could no longer be visibly detected in the solvent. Simulated human
saliva fluid consisted of: KCl 0.15 g/L, NaCl 0.12 g/L, Sodium
Bicarbonate 2.1 g/L, alpha-amylase 2.0 g/L and gastric mucin 1.0 g/L as
described in Davis et al. (1971) J. Pharm. Sci. 60(3):429-432.
Formulations included in this study consisted of: (A) 0.5% w/w
hydroxypropyl methylcellulose containing 2% w/w sorbitol (Formulation 1)
or 2% v/v glycerol (Formulation 2); (B) 1.5% w/w hydroxypropyl
methylcellulose containing 2% w/w sorbitol (Formulation 3) or 2% v/v
glycerol (Formulation 4); (C) 3% w/w hydroxypropyl methylcellulose
containing 2% w/w sorbitol (Formulation 5) or 2% w/v glycerol
(Formulation 6).
[0057] FIG. 36: PMAL C16 Significantly Improves Dissolution Time for
Films. Films of uniform weight were placed in sterile saline at
37.degree. C. under gentle stirring. Dissolution rate was calculated by
dividing the starting weight of the film by the time at which the film
could no longer be visibly detected in the solvent. Formulations included
in this study consisted of: (A) 0.5% w/w hydroxypropyl methylcellulose
containing 2% w/w sorbitol (Formulation 1) or 2% v/v glycerol
(Formulation 2); (B) 1.5% w/w hydroxypropyl methylcellulose containing 2%
w/w sorbitol (Formulation 3) or 2% v/v glycerol (Formulation 4); (C) 3%
w/w hydroxypropyl methylcellulose containing 2% w/w sorbitol (Formulation
5) or 2% w/v glycerol (Formulation 6).
[0058] FIG. 37: Film Formulations with and without PMAL C16 Protect
Adenovirus From Degradation in Saliva. Infectious titer of unformulated
virus (Ad Unform.) placed in simulated human salivary fluid for 5 minutes
dropped by a factor of 3 when compared to the same concentration of virus
incubated in sterile saline (Ad Control). The infectious titer of virus
formulated in standard film base (1.5% HPMC, FILM) significantly improved
the titer of the virus in simulated human saliva six-fold. The addition
of PMAL C16 enhanced protection of the virus from digestive amylase and
mucin. The infectious titer of this preparation (FILM+DET) was 22 times
that of the unformulated virus (Ad Unform.).
[0059] FIG. 38: Virus Significantly Impacts the Moisture Retained in Dried
Film Formulations. Moisture content for films of uniform weight
containing 1.25.times.10.sup.12 particles of recombinant adenovirus
(VIRUS) and blank controls was assessed by Karl Fischer titration
according to USP standards. Formulations included in this study consisted
of: (A) 0.5% w/w hydroxypropyl methylcellulose alone (Formulation1) or
containing 2% w/w sorbitol (Formulation 2) or 2% v/v glycerol
(Formulation 3); (B) 1.5% w/w hydroxypropyl methylcellulose alone
(Formulation 4) or containing 2% w/w sorbitol (Formulation 5) or 2% v/v
glycerol (Formulation 6); (C) 3% w/w hydroxypropyl methylcellulose alone
(Formulation 7) containing 2% w/w sorbitol (Formulation 8) or 2% v/v
glycerol (Formulation 9).
[0060] FIG. 39: PMAL C16 Profoundly Increases Moisture Content of Films
Containing Virus. Moisture content for films of uniform weight containing
1.25.times.10.sup.12 particles of recombinant adenovirus in base
formulation (BASE) and films including detergent (DET) was assessed by
Karl Fischer titration according to USP standards. (A) 0.5% w/w
hydroxypropyl methylcellulose alone (Formulation 1) or containing 2% w/w
sorbitol (Formulation 2) or 2% v/v glycerol (Formulation 3); (B) 1.5% w/w
hydroxypropyl methylcellulose alone (Formulation 4) or containing 2% w/w
sorbitol (Formulation 5) or 2% v/v glycerol (Formulation 6); (C) 3% w/w
hydroxypropyl methylcellulose alone (Formulation 7) containing 2% w/w
sorbitol (Formulation 8) or 2% v/v glycerol (Formulation 9)
[0061] FIG. 40: Recombinant Adenovirus Can Be Evenly Distributed Across
Large Film that can be Divided into Equal Unit Doses. A 3 cm.times.3 cm
film containing recombinant adenovirus was dried and divided into nine 1
cm.times.1 cm parts (black grid, lower right corner of plot). Each part
was reconstituted with sterile saline and titer assessed by an in vitro
assay. Data shown is representative of 3 different formulations.
Formulations included in this study consisted of: 0.5% w/w hydroxypropyl
methylcellulose containing 2% w/w sorbitol (Formulation 1), 1.5% w/w
hydroxypropyl methylcellulose containing 2% w/w sorbitol (Formulation 2)
and 3% w/w hydroxypropyl methylcellulose containing 2% w/v glycerol
(Formulation 3). Formulations were prepared in 120 mM PBS.
[0062] FIGS. 41A-41C: Formulations can significantly extend shelf-life of
recombinant adenovirus at ambient temperature in dried and reconstituted
films. 41A: 30 month Stability Profile for Ebola Vaccine in Solid Film
Matrix. 41B: 8 month Stability Profile of Ebola Vaccine Reconstituted
from Film Matrix and Stored in Liquid Form. Each preparation was stored
at 20.degree. C. This is markedly better than the stability seen after
reconstitution of a stable lyophilized formulation of the virus and
subsequent storage at 4.degree. C. (41C).
[0063] While the present disclosure is susceptible to various
modifications and alternative forms, specific example embodiments have
been shown in the figures and are herein described in more detail. It
should be understood, however, that the description of specific example
embodiments is not intended to limit the invention to the particular
forms disclosed, but on the contrary, this disclosure is to cover all
modifications and equivalents as illustrated, in part, by the appended
claims.
DESCRIPTION
[0064] The present disclosure generally relates to vaccine compositions
that may be administered to a subject via the buccal and/or sublingual
mucosa. In some embodiments, the present disclosure also relates to
methods for administration and preparation of such vaccine compositions.
[0065] The buccal and the sublingual mucosa are attractive for the
delivery of medicinal compounds and have largely been uninvestigated in
the context of protective immunization. The sublingual and the buccal
epithelium are highly vascularized, allowing direct entry into the
systemic circulation, avoiding pre-systemic metabolism of antigen in the
gastrointestinal tract. They harbor a dense lattice of professional
antigen presenting cells (APCs), contain many T lymphocytes and directly
access mucosal-associated lymphoid tissues. One of the many advantages of
the present disclosure, many of which are not discussed herein, is that a
vaccine composition of the present disclosure may be administered by
direct application to the cheek (buccal) or under the tongue
(sublingual), which may then induce a strong protective systemic and
mucosal immune response. Furthermore, in those embodiments where the
vaccine is a recombinant adenovirus ("Ad")-based vaccine, it may be
administered via the buccal and/or sublingual mucosa with significant
potential for successful vaccination of those with pre-existing immunity
to Ad5. Pre-existing immunity to Ad5 is a global phenomenon and is
currently the most significant limitation to the use of these vectors.
[0066] The buccal and sublingual mucosa contain an immobile expanse of
smooth muscle upon which of a variety of dosage forms such as lozenges,
gels, patches and films can reside (Pather, 2008). This supports an
epithelium of 40-50 layers of actively dividing squamous, non-keratinized
cells (Wertz, 1991). Although this layer is the most significant barrier
to the absorption of large molecules though the cheek, cell turnover is
slow (4-14 days), allowing for continued release of antigen (Hill, 1984).
Reagents that aid absorption of large molecules across the mucosa
(surfactants, cyclodextrins, polyacrylates) and polymers that facilitate
interaction with the surface (polycarbophil, carboxymethyl cellulose)
also protect labile molecules from degradation at ambient temperatures
(Hassan, 2010, Shojaei, 1998). Accordingly, the present disclosure is
also innovative in that it promotes a delivery method that could improve
vaccine potency and physical stability at ambient temperatures
[0067] In some embodiments, the present disclosure provides a vaccine
composition comprising an antigen dispersed within an amorphous solid. As
used herein, the term "antigen" means a substance that induces a specific
immune response in a host animal. The antigen may comprise a whole
organism, killed, attenuated or live (including killed, attenuated or
inactivated bacteria, viruses, fungi, parasites, prions or other
microbes); a subunit or portion of an organism; a recombinant vector
containing an insert with immunogenic properties; a piece or fragment of
DNA capable of inducing an immune response upon presentation to a host
animal or which contains the genetic material that allows expression of a
given antigen in cells that take up the DNA; a protein, a polypeptide, a
peptide, an epitope, a hapten, or any combination thereof. Alternatively,
the antigen may comprise a toxin or antitoxin.
[0068] In general, an amorphous solid suitable for use in the present
disclosure should be dissolvable upon contact with an aqueous liquid,
such as saliva. In some embodiments, amorphous solids suitable for use in
the present disclosure may be formed from any sugar, sugar derivative or
combination of sugars/derivatives so long as the sugar and/or derivative
is prepared as a liquid solution at a concentration that allows it to
flow freely when poured but also forms an amorphous phase at ambient
temperatures on a physical surface that facilitates this process, such as
aluminum or Teflon. Examples of suitable sugars may include, but are not
limited to glucose, dextrose, fructose, lactose, maltose, xylose,
sucrose, corn sugar syrup, sorbitol, hexitol, maltilol, xylitol,
mannitol, melezitose, raffinose, and a combination thereof. While not
being bound to any particular theory, it is believed that sugars minimize
interaction of the antigen with water during storage and drying, in turn,
preventing damage to the three dimensional shape of the antigen due to
crystal formation during the drying process and subsequent loss of
efficacy. An example of the surface characteristics of an amorphous solid
is illustrated in FIGS. 23A and 24D In some embodiments, an amorphous
solid suitable for use in the present disclosure may have a thickness of
about 0.05 micrometers to about 5 millimeters.
[0069] In addition, in some embodiments, certain sugars may also function
as a binder which may provide "substance" to pharmaceutical preparations
that contain small quantities of very potent medications for ease of
handling/administration. They may also hold components together or
promote binding to surfaces (like the film backing) to ease drug delivery
and handling. Lastly, they may also contribute to the overall
pharmaceutical elegance of a preparation by forming uniform glasses upon
drying.
[0070] In certain embodiments, the vaccine compositions of the present
disclosure also may comprise a water-soluble polymer including, but not
limited to, carboxymethyl cellulose, carboxyvinyl polymers, high amylose
starch, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl
methylcellulose, methylmethacrylate copolymers, polyacrylic acid,
polyvinyl alcohol, polyvinyl pyrrolidone, pullulan, sodium alginate,
poly(lactic-co-glycolic acid), poly(ethylene) oxide,
poly(hydroxyalkanoate) and a combination thereof.
[0071] Furthermore, in some embodiments, the vaccine compositions of the
present disclosure may further comprise one or more oils, polyalcohols,
surfactants, permeability enhancers, and/or edible organic acids.
Examples of suitable oils may include, but are not limited to,
eucalyptol, menthol, vacrol, thymol, methyl salicylate, verbenone,
eugenol, gerianol and a combination thereof. Examples of suitable
polyalcohols may include, but are not limited to, glycerol, polyethylene
glycol, propylene glycol, and a combination thereof. Examples of suitable
edible organic acids may include, but are not limited to, citric acid,
malic acid, tartaric acid, fumaric acid, phosphoric acid, oxalic acid,
ascorbic acid and a combination thereof. Examples of suitable surfactants
may include, but are not limited to, difunctional block copolymer
surfactants terminating in primary hydroxyl groups, such as Pluronic.RTM.
F68 commercially available from BASF, poly(ethylene) glycol 3000,
dodecyl-3-D-maltopyranoside, disodium PEG-4 cocamido MIPA-sulfosuccinate
("DMPS"), etc. It is believed that certain surfactants may minimize
interaction of the antigen with itself and other antigens and subsequent
formation of large aggregated particles that cannot effectively enter and
be processed by target and antigen presenting cells They may also be
capable of weakening cell membranes without causing permanent damage and,
through this mechanism, promote uptake of large particles though rugged
biological membranes such as the buccal mucosa.
[0072] In certain preferred aspects, an immunogenic composition of the
embodiments comprises a zwitterionic surfactant. In some embodiments, the
zwitterionic surfactant is a surfactant molecule which contains a group
which is capable of being positively charged and a group which is capable
of being negatively charged. In some embodiments, both the positively
charged and negatively charged groups are ionized at physiological pH
such that the molecule has a net neutral charge. In some embodiments, the
positively charged group comprises a protonated or quaternary ammonium.
In some embodiments, the negatively charged group comprises a sulfate, a
phosphate, or a carboxylate. The zwitterionic surfactant further
comprises one or more lipid groups consisting essentially of an alkyl,
cycloalkyl, or alkenyl groups. Preferably, the zwitterionic surfactant
comprises one or more lipid groups consisting essentially of an alkyl,
cycloalkyl, or alkenyl groups with a carbon chain of more than 12 carbon
atoms. In some embodiments, the lipid group has a carbon chain of 12-30
carbon atoms. In some embodiments, the lipid group has a carbon chain of
12-24 carbon atoms. In some embodiments, the lipid group has from 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, to 24 carbons, or any range
derivable thereof. In some embodiments, the zwitterionic surfactant is a
polymeric structure which contains multiple zwitterionic groups and
multiple lipid groups on a central backbone. In some embodiments, the
zwitterionic surfactant is a polymer which has from about 50 to about 200
repeating units wherein each repeating units comprises one positively
charged group, one negatively charged group, and one lipid group. In some
embodiments, the zwitterionic surfactant is a polymer which has a 75 to
150 repeating units. In some embodiments, the central backbone is an
alkyl, polyethylene glycol, or polypropylene chain. In some embodiments,
the central chain is an alkyl group.
[0073] Some non-limiting examples of zwitterionic surfactants include
3-(N,N-Dimethyltetradecylammonio)propanesulfonate (SB3-14),
3-(4-Heptyl)phenyl-3-hydroxypropyl)dimethylammoniopropanesulfonate
(C7BzO), 3-(decyldimethylammonio) propanesulfonate inner salt (SB3-10),
3-(dodecyldimethylammonio) propanesulfonate inner salt (SB3-12),
3-(N,N-dimethyloctadecylammonio) propanesulfonate (SB3-18),
3-(N,N-dimethyl-octylammonio) propanesulfonate inner salt (SB3-8),
3-(N,N-dimethylpalmitylammonio) propanesulfonate (SB3-16),
3-[N,N-dimethyl(3-myristoylaminopropyl)ammonio]propane-sulfonate
(ASB-14), CHAPS, CHAPSO, acetylated lecithin, alkyl(C12-30)
dialkylamine-N-oxide apricotamidopropyl betaine, babassuamidopropyl
betaine, behenyl betaine, bis 2-hydroxyethyl tallow glycinate, C12-14
alkyl dimethyl betaine, canolamidopropyl betaine, capric/caprylic
amidopropyl betaine, capryloamidopropyl betaine, cetyl betaine,
3-[(Cocamidoethyl)dimethylammonio]-2-hydroxypropanesulfonate,
3-[(Cocamidoethyl)dimethyl-ammonio]propanesulfonate, cocamidopropyl
betaine, cocamidopropyl dimethylamino-hydroxypropyl hydrolyzed collagen,
N-[3-cocamido)-propyl]-N,N-dimethyl betaine, potassium salt,
cocamidopropyl hydroxysultaine, cocamidopropyl sulfobetaine,
cocaminobutyric acid, cocaminopropionic acid, cocoamphodipropionic acid,
coco-betaine, cocodimethylammonium-3-sulfopropylbetaine,
cocoiminodiglycinate, cocoiminodipropionate, coco/oleamidopropyl betaine,
cocoyl sarcosinamide DEA, DEA-cocoamphodipropionate, dihydroxyethyl
tallow glycinate, dimethicone propyl PG-betaine, N,N-dimethyl-N-lauric
acid-amidopropyl-N-(3-sulfopropyl)-ammonium betaine,
N,N-dimethyl-N-myristyl-N-(3-sulfopropyl)-ammonium betaine,
N,N-dimethyl-N-palmityl-N-(3-sulfopropyl)-ammonium betaine,
N,N-dimethyl-N-stearamidopropyl-N-(3-sulfopropyl)-ammonium betaine,
N,N-dimethyl-N-stearyl-N-(3-sulfopropyl)-ammonium betaine,
N,N-dimethyl-N-tallow-N-(3-sulfopropyl)-ammonium betaine, disodium
caproamphodiacetate, disodium caproamphodipropionate, disodium
capryloamphodiacetate, disodium capryloamphodipropionate, disodium
cocoamphodiacetate, disodium cocoamphodipropionate, di sodium
isostearoamphodipropionate, disodium laureth-5 carboxyamphodiacetate,
disodium lauriminodipropionate, disodium lauroamphodiacetate, disodium
lauroamphodipropionate, disodium octyl b-iminodipropionate, disodium
oleoamphodiacetate, disodium oleoamphodipropionate, disodium
PPG-2-isodeceth-7 carboxyamphodiacetate, disodium soyamphodiacetate,
disodium stearoamphodiacetate, disodium tallamphodipropionate, disodium
tallowamphodiacetate, disodium tallowiminodipropionate, disodium
wheatgermamphodiacetate,
N,N-distearyl-N-methyl-N-(3-sulfopropyl)-ammonium betaine,
erucamidopropyl hydroxysultaine, ethylhexyl dipropionate, ethyl
hydroxymethyl oleyl oxazoline, ethyl PEG-15 cocamine sulfate,
hydrogenated lecithin, hydrolyzed protein, isostearamidopropyl betaine,
3-[(Lauramidoethyl)dimethylammonio]-2-hydroxypropanesulfonate,
3-[(Lauramidoethyl)dimethylammonio]propanesulfonate, lauramido-propyl
betaine, lauramidopropyl dimethyl betaine, lauraminopropionic acid,
lauroamphodipropionic acid, lauroyl lysine, lauryl betaine, lauryl
hydroxysultaine, lauryl sultaine, linoleamidopropyl betaine,
lysolecithin, milk lipid amidopropyl betaine, myristamidopropyl betaine,
octyl dipropionate, octyliminodipropionate,
n-octyl-N,N-dimethyl-3-ammonio-1-propanesulfonate,
n-decyl-N,N-dimethyl-3-ammonio-1-propanesulfonate,
n-dodecyl-N,N-dimethyl-3-ammonio-1-propane-sulfonate,
n-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate,
n-hexadecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate,
n-octadecyl-N,N-dimethyl-3-ammonio-1-propane-sulfonate, oleamidopropyl
betaine, oleyl betaine, 4,4(5H)-oxazoledimethanol, 2-(heptadecenyl)
betaine, palmitamidopropyl betaine, palmitamine oxide, PMAL-C6, PMAL-C12,
PMAL-C16, ricinoleamidopropyl betaine, ricinoleamidopropyl betaine/IPDI
copolymer, sesamidopropyl betaine, sodium C12-15 alkoxypropyl
iminodipropionate, sodium caproamphoacetate, sodium capryloamphoacetate,
sodium capryloamphohydroxypropyl sulfonate, sodium
capryloamphopropionate, sodium carboxymethyl tallow polypropylamine,
sodium cocaminopropionate, sodium cocoamphoacetate, sodium
cocoamphohydroxypropyl sulfonate, sodium cocoamphopropionate, sodium
dicarboxyethyl cocophosphoethyl imidazoline, sodium hydrogenated tallow
dimethyl glycinate, sodium isostearoamphopropionate, sodium
lauriminodipropionate, sodium lauroamphoacetate, sodium
oleoamphohydroxypropylsulfonate, sodium oleoamphopropionate, sodium
stearoamphoacetate, sodium tallamphopropionate, soyamidopropyl betaine,
stearyl betaine,
3-[(Stearamidoethyl)dimethylammonio]-2-hydroxypropanesulfonate,
3-[(Stearamidoethyl)-dimethylammonio]propanesulfonate, tallowamidopropyl
hydroxysultaine, tallowamphopoly-carboxypropionic acid, trisodium
lauroampho PG-acetate phosphate chloride, undecylenamidopropyl betaine,
and wheat germamidopropyl betaine.
[0074] A vaccine composition of the present disclosure further comprises
an antigen. Antigens suitable for use in the present disclosure may
include any antigen for which cellular and/or humoral immune responses
are desired, including antigens derived from viral, bacterial, fungal and
parasitic pathogens and prions that may induce antibodies, T-cell helper
epitopes and T-cell cytotoxic epitopes. Such antigens include, but are
not limited to, those encoded by human and animal viruses and can
correspond to either structural or non-structural proteins. Furthermore,
the present disclosure contemplates vaccines made using antigens derived
from any of the antigen sources discussed below and those that use these
sources as potential delivery devices or vectors. For example, in one
specific embodiment, recombinant adenovirus may be used to deliver Ebola
antigens for immunization against Ebola infection.
[0075] Antigens useful in the present disclosure may include those derived
from viruses including, but not limited to, those from the family
Arenaviridae (e.g., Lymphocytic choriomeningitis virus), Arterivirus
(e.g., Equine arteritis virus), Astroviridae (Human astrovirus 1),
Birnaviridae (e.g., Infectious pancreatic necrosis virus, Infectious
bursal disease virus), Bunyaviridae (e.g., California encephalitis virus
Group), Caliciviridae (e.g., Caliciviruses), Coronaviridae (e.g., Human
coronaviruses 299E and OC43), Deltavirus (e.g., Hepatitis delta virus),
Filoviridae (e.g., Marburg virus. Ebola virus). Flaviviridae (e.g.,
Yellow fever virus group, Hepatitis C virus), Hepadnaviridae (e.g.,
Hepatitis B virus), Herpesviridae (e.g., Epstein-Bar virus. Simplexvirus,
Varicellovirus, Cytomegalovirus, Roseolovirus, Lymphocryptovirus,
Rhadinovirus), Orthomyxoviridae (e.g., Influenzavirus A, B, and C),
Papovaviridae (e.g., Papillomavirus), Paramyxoviridae (e.g.,
Paranmyxovirus such as human parainfluenza virus 1, Morbillivirus such as
Measles virus, Rubulavirus such as Mumps virus, Pneumovirus such as Human
respiratory syncytial virus), Picornaviridae (e.g., Rhinovirus such as
Human rhinovirus 1A, Hepatovirus such Human hepatitis A virus, Human
poliovirus. Cardiovirus such as Encephalomyocarditis virus, Aphthovirus
such as Foot-and-mouth disease virus O, Coxsackie virus), Poxyiridae
(e.g., Orthopoxvirus such as Variola virus or monkey poxvirus),
Reoviridae (e.g., Rotavirus such as Groups A-F rotaviruses), Retroviridae
(Primate lentivirus group such as human immunodeficiency virus 1 and 2),
Rhabdoviridae (e.g., rabies virus), Togaviridae (e.g., Rubivirus such as
Rubella virus), Human T-cell leukemia virus. Murine leukemia virus,
Vesicular stomatitis virus, Wart virus, Blue tongue virus, Sendai virus,
Feline leukemia virus, Simian virus 40, Mouse mammary tumor virus, Dengue
virus, HIV-1 and HIV-2, West Nile, H1N1, SARS, 1918 Influenza, Tick-borne
encephalitis virus complex (Absettarov, Hanzalova, Hypr), Russian
Spring-Summer encephalitis virus, Congo-Crimean Hemorrhagic Fever virus,
Junin Virus, Kumlinge Virus, Marburg Virus, Machupo Virus, Kyasanur
Forest Disease Virus, Lassa Virus, Omsk Hemorrhagic Fever Virus, FIV,
SIV, Herpes simplex 1 and 2, Herpes Zoster. Human parvovirus (B19),
Respiratory syncytial virus, Pox viruses (all types and serotypes),
Coltivirus, Reoviruses--all types, and/or Rubivirus (rubella).
[0076] Antigens useful in the present disclosure may include those derived
from bacteria including, but not limited to, Streptococcus agalactiae,
Legionella pneumophilia, Streptococcus pyogenes, Escherichia coli,
Neisseria gonorrhosae, Neisseria meningitidis, Pneumococcus, Hemophilis
influenzae B, Treponema pallidum, Lyme disease spirochetes, Pseudomonas
aeruginosa, Mycobacterium leprae, Brucella abortus, Mycobacterium
tuberculosis, Plasmodium falciparum, Plasmodium vivax, Toxoplasma gondii,
Trypanosoma rangeli, Trypanosoma cruzi, Trypanosoma rhodesiensei,
Trypanosoma brucei, Schistosoma mansoni, Schistosoma japacum, Babesa
bovis, Elmira tenella, Onchocerca volvulus, Leishmania tropica,
Trichinella spiralis, Theileria parva, Taenia hydatigena, Taenia ovis,
Taenia saginata, Echinococcus granulosus, Mesocestoides corti, Mycoplasma
arthritidis, M. hyorhinis, M. orale, M. arginini, Acholeplasma laidlawii,
M. salivarium, M. pneumoniae, Candida albicans, Cryptococcus neoformans,
Histoplasma capsullum, Coccidioides immitis, Blastomyces dermatitidis,
Aspergillus fumigatus, Penicillium marneffei, Bacillus anthracis,
Bartonella, Bordetella pertussis, Brucella--all serotypes, Chlamydia
trachomatis, Chlamydia pneumoniae, Clostridium botulinum--anything from
clostridium serotypes, Haemophilus influenzae, Helicobacter pylori,
Klebsiella--all serotypes, Legionella--all serotypes, Listeria,
Mycobacterium--all serotypes, Mycoplasma--human and animal serotypes,
Rickettsia--all serotypes, Shigella--all serotypes, Staphylococcus
aureus, Streptococcus--S. pneumoniae, S. pyogenes, Vibrio cholera,
Yersinia enterocolitica, and/or Yersinia pestis.
[0077] Antigens useful in the present disclosure may include those derived
from parasites including, but not limited to, Ancylostoma human
hookworms, Leishmania--all strains, Microsporidium. Necator human
hookworms, Onchocerca filarial worms, Plasmodium--all human strains and
simian species, Toxoplasma--all strains, Trypanosoma--all serotypes,
and/or Wuchereria bancrofti filarial worms.
[0078] In another embodiment, an antigen is an aberrant protein derived
from a sequence which has been mutated. Such antigens may include those
expressed by tumor cells or aberrant proteins whose structure or
solubility leads to the formation of an aggregation-prone product and
cause disease. Examples of aberrant proteins may include, but are not
limited to, Alzheimer's amyloid peptide, SOD1, presenillin 1 and 2,
.alpha.-synuclein, amyloid A, amyloid P, CFTR, transthyretin, amylin,
lysozyme, gelsolin, p53, rhodopsin, insulin, insulin receptor, fibrillin,
.alpha.-ketoacid dehydrogenase, collagen, keratin, PRNP, immunoglobulin
light chain, atrial natriuretic peptide, seminal vesicle exocrine
protein, .beta.2-microglobulin, PrP, precalcitonin, ataxin 1, ataxin 2,
ataxin 3, ataxin 6, ataxin 7, huntingtin, androgen receptor, CREB-binding
protein, dentaorubral pallidoluysian atrophy-associated protein,
maltose-binding protein, ABC transporter, glutathione-S-transferase, and
thioredoxin.
[0079] In one embodiment, a vaccine composition comprising an amorphous
solid may be made by preparing a solution comprising a sugar, sugar
derivative or combination of sugars/derivatives in a buffer and
optionally other additives previously mentioned. In some embodiments, a
sugar, sugar derivative or combination of sugars/derivatives may be
present in the solution in an amount up to about 60% by weight of the
solution. In some embodiments, an additive may be present in an amount of
about 5% or less by weight of the solution. In general, the solution
comprising the sugar, sugar derivative or combination of
sugars/derivatives is made at a concentration higher than the desired
final concentration to compensate for any dilution that may occur when
the antigen is added. The desired antigen may be added to the solution at
a concentration known to induce the desired immune response. The mixture
may then be stirred at ambient temperature until a substantially
homogeneous mixture is obtained. In some embodiments, the mixture may
then be briefly sonicated under cooled conditions, e.g. 4.degree. C., to
remove any air bubbles that may have developed. In other embodiments, the
mixture may be slightly heated, e.g., heated to 40.degree. C. or below,
slightly cooled, and in some instances may be frozen. In some
embodiments, a vaccine composition of the present disclosure may be made
without freeze drying or spray draying. The final formulation may then be
cast onto a flat backing surface in a laminar flow hood and allowed to
form an amorphous solid at ambient temperatures (15-20.degree. C.).
Examples of suitable backing surfaces may include, but are not limited
to, thin layers of aluminum, Teflon, silicate, polyetheretherketone, low
density polyethylene, ethyl cellulose, etc. Once the process is complete
the vaccine composition can be peeled from the backing and placed in the
mouth for immunization purposes and/or stored at ambient temperature for
up to three years from manufacture.
[0080] In another embodiment, a vaccine composition of the present
disclosure may be made by contacting an amorphous solid with an antigen,
or optionally, mixing an antigen with one or more excipients
(surfactants, sugars, starches, etc.) and contacting the amorphous solid
with the mixture so as to dispose the antigen within the amorphous solid.
In some embodiments, the mixture is then allowed to dry, which is then
ready for administration.
[0081] In some embodiments, vaccine compositions of the present disclosure
may further comprise a protective layer disposed on a surface of an
amorphous solid comprising an antigen. Exemplary protective layers may
include, but are not limited to, an additional layer(s) of film, such as
polyethylene, polyurethane, polyether etherketone, etc., and/or an
additional layer(s) of an amorphous solid that does not contain any
antigen.
[0082] The amount of antigen that may be used in a vaccine composition of
the present disclosure may vary greatly depending upon the type of
antigen used, the formulation used to prepare the vaccine composition,
the size of the amorphous solid, the solubility of the antigen, etc. One
of ordinary skill in the art with the benefit of this disclosure will be
able to determine a suitable amount of antigen to include in a vaccine
composition of the present disclosure. In one embodiment, a vaccine
composition may comprise about 1.times.10.sup.6 to about
1.times.10.sup.13 virus particles for a virus-based vaccine or about
1.times.10.sup.3 to about 1.times.10.sup.13 colony forming units for a
bacteria-based vaccine or about 0.1 mg-1 g of protein for subunit
vaccines.
[0083] It is also important to note that when formulating a vaccine
composition of the present disclosure one must also consider any toxicity
and/or adverse effects. Furthermore, in an effort to create a stable
vaccine composition, it may also be important to identify a ratio of
ingredients that interacts with water and the antigen in a manner that
prevents crystallization during drying Formation of water crystals will
puncture the virus coat or bacterial wall and compromise the overall
potency of the vaccine. Formulations that do this to the highest degree
are said to form glasses.
[0084] Any substantially solid surface can be used for casting and/or
drying compositions of the embodiments. For example, the surface can be a
polymer (e.g., plastic) or a metal surface. In some aspects, the surface
has a low coefficient of friction (e.g., a siliconized, non-stick
surface) to provide easy removal of films. In some embodiments, a glass
plate can be used for casting of the vaccine compositions. Composition
that have been cast on a surface can then be dried, for instance, under a
controlled, laminar flow of air at room temperature, or under
refrigerated conditions. Similarly, vaccine compositions suitable for use
in the present disclosure can be prepared in a single-layer or
multi-layers.
[0085] In general, the vaccine compositions of the present disclosure may
be formulated so as to dissolve in a relatively short period of time, for
example, from about 5 to 60 seconds or 1 to 30 minutes. When
administered, a vaccine composition of the present disclosure may be
handled by a portion of the composition that does not contain an antigen
and may be placed in the upper pouch of the cheek for buccal delivery, or
far under the tongue for sublingual delivery or reconstituted and
utilized as a solution for inhalation or as a nasal spray.
[0086] In some embodiments, the compositions and methods of the present
disclosure may also be used as a means for treating a variety of
malignant cancers. For example, the vaccine compositions of the present
disclosure can be used to mount both humoral and cell-mediated immune
responses to particular proteins specific to the cancer in question, such
as an activated oncogene, a fetal antigen, or an activation marker Such
tumor antigens include any of the various MAGEs (melanoma associated
antigen E), including MAGE 1, 2, 3, 4, etc.; any of the various
tyrosinases; MART 1 (melanoma antigen recognized by T cells), mutant ras;
mutant p53; p97 melanoma antigen; CEA (carcinoembryonic antigen), among
others.
[0087] In certain aspects, methods are provided for producing immunogenic
compositions in substantially solid carriers. Such a method may comprise
obtaining or formulating a solution comprising sufficient stabilizers
(e.g., sugars and sugar derivatives, polymers) and permeability enhancers
(e.g., surfactants, such as a zwitterionic surfactant of the embodiments)
in a solvent system (e.g., distilled deionized water, ethanol, methanol).
In some cases, formulation is such that the total amount of solid
components added to the solvent are within the concentration of 10%-90%
w/w. This suspension can be prepared by stirring, homogenization, mixing
and/or blending these compounds with the solvent. In some cases, small
portions of each component (.about. 1/10 the total amount) are added to
the solvent and the solution mixed before adding additional portions of
the same agent or a new agent.
[0088] In certain aspects, once each stabilizer and permeability enhancer
is added, the bulk solution is placed at 4.degree. C. for a period of
time between 2-24 hours. In some aspects, the bulk solution is subjected
additional homogenization, such as sonication (e.g., for a period of 5-60
minutes) to remove trapped air bubbles in the preparation. After
sonication is complete, the antigen, such as a viral vector, is added to
the preparation. In some cases, the amount of antigen will range from of
0.1-30% of the total solid concentration. Adjuvants, optionally, can also
be added at this time. In some aspects, the amount of adjuvant compounds
will range from 0.005-10% of the total solid concentration. Again, in
some aspects, these agents will be added by gentle stirring (e.g., 10-50
rpm) so as to not induce airpockets/bubble formation in the final
preparation.
[0089] In some cases, the preparation is then slowly piped into molds of a
shape suitable for the application. The molds can be constructed of a
variety of materials including, but not limited to, stainless steel,
glass, silicone, polystyrene, polypropylene and other pharmaceutical
grade plastics. In some cases, the preparation can be placed in the molds
by slowly pouring by hand or by pushing the preparation through a narrow
opening on a collective container at a slow controlled rate (e.g., 0.25
ml/min) to prevent early hardening and/or bubble formation in the final
film product. In certain preferred aspects, films will be poured to a
thickness of 12.5-1000 .mu.m. In some aspects, molds for casting of films
will be sterilized by autoclaving and placed in laminar air flow hoods
prior to casting.
[0090] In further aspects, molds may also be lined with a peelable backing
material suitable for protection of the film product. Suitable backings
include, without limitation, aluminum, gelatin, polyesters, polyethylene,
polyvinyl and poly lactic co-glycolide polymers, wax paper and/or any
other pharmaceutically acceptable plastic polymer.
[0091] In some cases, cast films will remain at ambient temperature (e.g.,
20-25.degree. C.), such as in a laminar flow hood for 2-24 hours after
which time a thin, peelable film will be formed. In some cases, this film
may be opaque or translucent. In some cases, films are stored at room
temperature under controlled humidity conditions. However, in certain
aspects, films can be stored at lower temperatures, such as at 4.degree.
C., under controlled humidity as well.
[0092] In certain aspects, multilayer films can also be created at this
time by applying a second coating of as solution containing the same
antigen as the first layer or another different adjuvant/antigen system
to the thin film. Again, in some cases, this will remain at ambient
temperature (e.g., 20-25.degree. C.), such as in a laminar flow hood, for
an additional 2-24 hours after which time a thin, peelable film will be
formed. Again the film may be opaque or translucent.
[0093] In certain cases, films will be dissolved in a solution prior to
use. For example, water or warmed saline (e.g., .about.37.degree. C.,
body temperature) may be used. In some cases, the resulting solution can
be screened for antigen confirmation and activity to determine the
effectiveness of the formulation to retain the potency of the preparation
over time.
[0094] To facilitate a better understanding of the present invention, the
following examples of certain aspects of some embodiments are given. In
no way should the following examples be read to limit, or define, the
entire scope of the invention.
Example 1
Materials and Methods (Examples 2-8)
[0095] Materials--
[0096] Acepromazine was purchased from Fort Dodge Laboratories (Atlanta,
Ga.). Ketamine was purchased from Wyeth, Fort Dodge, Animal Health,
(Overland Park, Kans.). Dulbecco's phosphate-buffered saline (DPBS),
xylazine, tresyl chloride activated monomethoxypoly(ethylene)glycol,
L-lysine, Poly(ethylene) glycol 3000, ethyl acetate,
poly(lactide-co-glycolide) copolymers (PLGA, 50:50 lactide:glycolide),
polyvinyl alcohol (PVA), glutaraldehyde (Grade I, 25% in water),
o-phenylenediamine, sucrose (USP grade), D-mannitol (USP grade),
D-sorbitol (USP grade), bovine serum albumin (RIA grade), Brefeldin A,
potassium ferricyanide and potassium ferrocyanide were purchased from
Sigma-Aldrich (St. Louis, Mo.). Eosin Y and Tween 20 were purchased from
Fisher Scientific (Kalamazoo, Mich. and Pittsburgh, Pa. respectively).
Melezitose monohydride was purchased from MP Biomedicals (Solon, Ohio)
and raffinose pentahydrate from Alfa Aesar (Ward Hill, Mass.). Sodium
hydroxide, potassium phosphate monobasic, potassium phosphate dibasic and
sodium dodecyl sulfate were purchased from Mallinckrodt Baker
(Phillipsburg, N.J.). Pluronic F68 was purchased from BASF (Mount Olive,
N.J.). Dulbecco's Modified Eagle's medium (DMEM), RPMI-1640, Minimal
Essential Medium (MEM) and L-glutamine were purchased from Mediatech
(Manassas, Va.). Fetal bovine serum (qualified, US origin), penicillin
and streptomycin were purchased from Gibco Life Technologies (Grand
Island, N.Y.). Sodium pyruvate and non-essential amino acids were
purchased from Lonza (Walkersville, Md.).
5-bromo-4-chloro-3-indolyl-3-D-galactoside (X-gal) was purchased from
Gold Biotechnology (St. Louis, Mo.). N-dodecyl-.beta.-D-maltopyranoside
(nDMPS), poly (Maleic Anhydride-alt-1-Decene) substituted with
3-(Dimethylamino) Propylamine (PMAL C8, formula weight (F.W.) 8,500),
poly (Maleic Anhydride-alt-1-Tetradecene) substituted with
3-(Dimethylamino) Propylamine (PMAL C12, F.W. 12,000) and poly (Maleic
Anhydride-Alt-1-Octadecene) substituted with 3-(Dimethylamino)
Propylamine (PMAL C16, F.W. 39,000) were purchased from Anatrace (Maumee,
Ohio). The TELRTFSI (SEQ ID NO: 1) peptide was purchased from New England
Peptide (Gardner, Mass.). The negative control peptide (YPYDVPDYA (SEQ ID
NO: 2)) was purchased from GenScript (Piscataway, N.J.). Antibodies used
for ELISPOT and flow cytometry, Cytofix/Cytoperm and Perm/Wash reagents
were purchased from BD Pharmingen (San Diego, Calif.).
[0097] Adenovirus Production--
[0098] Four different recombinant adenoviruses were used in these
examples. All were first generation E1/E3 deleted recombinant adenovirus
serotype 5 vectors that differed only by transgene expression cassettes.
Two vectors, AdlacZ, expressing E. coli beta-galactosidase and AdGFP,
expressing green fluorescent protein were used for rapid screening of the
transduction efficiency of formulations in vitro and in vivo due to the
ease by which their transgene products could be visualized and
quantitated. AdNull, an E1/E3 deleted adenovirus 5 vector with a similar
genetic backbone as the other viruses used in these examples except that
it does not contain a marker transgene expression cassette, was used to
induce pre-existing immunity to adenovirus 5 in mice prior to
immunization. These viruses were each amplified in HEK 293 cells (ATCC
CRL-1573 Manassas, Va.). They were purified from cell lysates by banding
twice on cesium chloride gradients and desalted over Econo-Pac 10 DG
disposable chromatography columns (BioRad, Hercules, Calif.) equilibrated
with potassium phosphate buffer (KPBS, pH 7.4). The concentration of each
preparation was determined by UV spectrophotometric analysis at 260 nm
and by an infectious titer assay as described.sup.18. Preparations with a
ratio of infectious to physical particles of 1:100 were used for these
examples. For immunization and challenge studies, an E1/E3 deleted
recombinant adenovirus serotype 5 vector expressing a codon optimized
full-length Ebola glycoprotein sequence under the control of the chicken
.beta.-actin promoter (Ad-CAGoptZGP) was amplified in HEK 293 cells and
purified as describe d (Choi et al., 2013). Concentration of this and
AdNull was determined by UV spectrophotometric analysis at 260 nm and
with the Adeno-X Rapid Titer Kit (Clontech, Mountain View, Calif.)
according to the manufacturer's instructions. Preparations with
infectious to physical particle ratios of 1:200 of each of these viruses
were used in these examples.
[0099] PEGylation of Adenovirus--
[0100] PEGylation was performed according to established protocols (Croyle
et al., 2000; Wonganan et al., 2010). Characterization of these
preparations revealed significant changes in the biophysical properties
of the virus such as the PEG-dextran partition coefficient and peak
elution times during capillary electrophoresis (Wonganan et al., 2010).
Approximately 18,245.+-.546 PEG molecules were associated with each virus
particle in the examples outlined here as determined by a PEG-biotin
assay (Croyle et al., 2005).
[0101] PLGA Microspheres--
[0102] PLGA microspheres were prepared using a standard
water-in-oil-in-water (W/O/W) double emulsion and solvent evaporation
method (Danhier et al., 2012). One milliliter of virus (5.times.10.sup.12
virus particles) was added to ethyl acetate containing 100 mg PLGA. The
primary water-in-oil emulsion was prepared by homogenization for 30
seconds and was then added to 10 milliliters of an aqueous solution
containing 5% (w/v) PVA. The secondary W/O/W emulsion was prepared by
homogenization for 60 seconds and further agitated with a magnetic
stirring rod for 2 hours at 4.degree. C. to evaporate the co-solvent.
Microspheres were collected by centrifugation at 2,000 rpm for 3 minutes
and washed five times with sterile KPBS. The diameter of the microspheres
fell between 0.3 to 5 .mu.m with an average particle size of 2.06.+-.1.4
.mu.m as determined by dynamic light scattering using a DynaPro LSR laser
light scattering device and detection system (Wyatt Technology, Santa
Barbara, Calif.). Regularization histograms and assignment of
hydrodynamic radii values to various subpopulations within the sample
were calculated using DynaLS software (Wyatt). The amount of virus
embedded in the microspheres was determined by digesting a portion of
each preparation with 1 N NaOH for 24 hours. The average encapsulation
efficiency of this process was 21.6.+-.4.4% (n=6). Aliquots of each
preparation were dried, placed in sterile, light resistant containers and
stored at room temperature for evaluation of stability over time. Release
profiles of each preparation were determined by placing 10 mg of
microspheres in 0.5 ml sterile KPBS on a magnetic stir plate (Corning,
Tewksbury Mass.) in a 37.degree. C. incubator. Each day, microspheres
were collected by centrifugation, the supernatant collected and replaced
with KPBS pre-warmed to 37.degree. C. The number of infectious virus
particles released from microspheres was determined by serial dilution of
collected samples and subsequent infection of Calu-3 cells (ATCC,
HTB-55), an established model of the airway epithelia (Ong et al., 2013).
Example 2
In Vitro Screening of Formulations
[0103] Two vectors, AdlacZ, expressing E. coli beta-galactosidase and
AdGFP, expressing green fluorescent protein were used for rapid screening
of the transduction efficiency of formulations due to the ease by which
their transgene products could be visualized and quantitated.
Formulations were prepared at five times the working concentration,
sterilized by filtration and diluted with freshly purified virus in KPBS
(pH 7.4) prior to use. Two hundred microliters of formulation containing
virus (MOI 100) in the absence or presence of anti-adenovirus antibodies
were added to differentiated Calu-3 cells seeded at a density of
1.25.times.10.sup.5 cells/well in 12 well plates. Formulations remained
in contact with cell monolayers for 2 hours at 37.degree. C. in 5%
CO.sub.2. Cytotoxicity was assessed by measuring lactate dehydrogenase
(LDH) release into the formulation with a standard cytotoxicity kit
(Roche Applied Science, Indianapolis, Ind.) according to the
manufacturer's instructions. Complete lysis was achieved by adding 1%
sodium dodecyl sulfate to cells not exposed to formulations (positive
control). Transduction efficiency was measured 48 hours later by either
histochemical staining, visual inspection and quantitation of cells
expressing beta-galactosidase or by flow cytometry to quantitate cells
expressing GFP.
Example 3
Mouse Studies
[0104] All procedures were approved by the Institutional Animal Care and
Use Committees at The University of Texas at Austin and the University of
Texas Medical Branch in Galveston and are in accordance with the
guidelines established by the National Institutes of Health for the
humane treatment of animals. Two different strains of mice were used in
these examples. Male B10.Br mice (MHC H-2.sup.k) were used to
characterize the immune response to Ebola glycoprotein after immunization
with the Ad-CAGoptZGP vector as described previously (Croyle et al.,
2008; Choi et al., 2012; Choi et al., 2013). Because this strain is
difficult to breed (Lerner et al., 1992), and is often not readily
available in quantities sufficient from the supplier to perform the
studies outlined in this manuscript, male C56/BL6 (MHC H-2.sup.d) mice
were used for initial screening of formulations that improved transgene
expression in vitro with minimal cytotoxic effects. Both strains were
obtained from the Jackson Laboratory (age 4-6 weeks, Bar Harbor, Me.).
[0105] Nasal Administration of Virus/Immunization--
[0106] Animals were housed in a temperature-controlled, 12 hour
light-cycled facility at the Animal Research Center of The University of
Texas at Austin with free access to standard rodent chow (Harlan Teklad,
Indianapolis, Ind.) and tap water. Animals were anesthetized by a single
intra-peritoneal injection of a 3.9:1 mixture of ketamine (100 mg/ml) and
xylazine (100 mg/ml). Once deep plane anesthesia was achieved, animals
were placed on their stomach. The sedate animal's head was rested upon an
empty tuberculin syringe to keep the head in an upright position and to
minimize choking or accidental swallowing of vaccine (FIG. 9). Each mouse
received a dose of 1.times.10.sup.8 infectious particles of unformulated
or formulated vaccine by direct application in the nasal cavity. The
inhalation pressure from the animal's natural breathing was sufficient to
allow small droplets from the standard micropipette (Gilson, Middleton,
Wis.) to gently enter the nasal cavity without the need to forcefully
inject the solution. The right nostril received 10 .mu.L and was allowed
to dry for up to 5 minutes before adding an additional 10 .mu.L to the
left nostril, for a total volume of 20 .mu.L per animal. The animal was
observed in the relaxed position for an additional 10 minutes to
guarantee comfortable breathing and ensure that the vaccine was not lost
via sneezing (a rare occurrence that can result from touching the
animal's nose with the micropipette tip instead of allowing the tiny
droplet to be gently pulled into the nose through natural inhalation
pressure).
[0107] Establishment of Pre-Existing Immunity to Adenovirus--
[0108] first generation adenovirus that that does not contain a transgene
cassette (AdNull) was used to establish pre-existing immunity to
adenovirus serotype 5 (Callahan et al., 2006). Twenty-eight days prior to
vaccination, mucosal PEI was induced by placing 5.times.10.sup.10
particles of AdNull in the nasal cavity as described above under the
immunization protocol. Twenty-four days later, blood was collected via
the saphenous vein and serum screened for anti-Ad neutralizing antibodies
(NABs) as described below. At the time of vaccination, animals had an
average anti-Ad circulating NAB titer of 315.+-.112 reciprocal dilution,
which falls within the range of average values reported in humans after
natural infection (Barouch et al., 2011).
[0109] Challenge with Mouse-Adapted Ebola Virus--
[0110] Challenge experiments were performed under biosafety level 4
(BSL-4) conditions in an AAALAC accredited animal facility at the Robert
E. Shope BSL-4 Laboratory at the University of Texas Medical Branch in
Galveston, Tex. Twenty-one days post-immunization, vaccinated mice were
transported to the BSL-4 lab where they were challenged on day 28 by
intraperitoneal injection with 1,000 pfu of mouse-adapted
(30,000.times.LD.sub.50) Ebola (Bray et al., 1999). After challenge,
animals were monitored for clinical signs of disease and weighed daily
for 14 days. Serum alanine aminotransferase (ALT) and aspartate
aminotransferase (AST) levels were determined using AST/SGOT and ALT/SGPT
DT slides on a Vitros DTSC autoanalyzer (Ortho Clinical Diagnostics,
Rochester, N.Y.).
Example 4
In Vitro Studies with Immunized Samples
[0111] ELISPOT--
[0112] ELISpot assays were performed using the ELISpot Mouse Set (BD
Pharmingen) according to the manufacturer's instructions. Mononuclear
cells were isolated from the spleen and bronchoalveolar lavage fluid as
described previously (Choi et al., 2013), washed twice with complete DMEM
and added to wells of a 96-well ELISpot plate (5.times.10.sup.5
cells/well) with the TELRTFSI peptide ((SEQ ID NO: 1), 0.5 .mu.g/well)
that carries the Ebola virus glycoprotein immunodominant MHC class I
epitope for mice with the H-2.sup.k haplotype (B10.Br) (Rao et al.,
1999). Negative control cells were stimulated with an irrelevant peptide,
which carries a binding sequence for influenza hemagglutinin (YPYDVPDYA
(SEQ ID NO: 2), 0.5 .mu.g/well). Spots were counted using an automated
ELISpot reader (CTL-ImmunoSpot.RTM. S5 Micro Analyzer, Cellular
Technology Ltd., Shaker Heights, Ohio).
[0113] Multi-Parameter Flow Cytometry--
[0114] Splenocytes (2.times.10.sup.6) isolated from immunized mice were
cultured with TELRTFSI peptide ((SEQ ID NO: 1), 0.5 .mu.g/well) and 1
.mu.g/ml Brefeldin A for 5 hours at 37.degree. C. in 5% CO.sub.2.
Negative control cells were incubated with the YPYDVPDYA peptide ((SEQ ID
NO: 2), 0.5 .mu.g/well). Following stimulation, cells were surface
stained with anti-mouse CD8a antibodies (1:150 in DPBS) and followed by
intracellular staining with anti-mouse IFN-.gamma., TNF-.alpha. and IL-2
antibodies as described (Choi et al., 2013). Positive cells were counted
using four-color flow cytometry (FACS Fortessa, BD Biosciences, Palo
Alto, Calif.). Over 500,000 events were captured per sample. Data were
analyzed using FlowJo software (Tree Star, Inc., Ashland, Oreg.).
[0115] CFSE Assay--
[0116] Splenocytes were isolated 42 days post-vaccination, stained using
the Vybrant CFDA SE Cell Tracer kit (Invitrogen, Carlsbad, Calif.),
seeded at a concentration of 5.times.10.sup.5 cells/well in 96 well
plates and cultured for 5 days at 37.degree. C. with 5% CO.sub.2 in the
presence of the TELRTFSI (SEQ ID NO: 1) or YPYDVPDYA (SEQ ID NO: 2)
peptides (0.5 .mu.g/well) as described previously (Choi et al., 2012).
Cells were incubated with a cocktail of antibodies (perCPCy5.5
labeled-anti-mouse-CD8, PE labeled-anti-mouse-CD44, and allophycocyanin
(APC) labeled-anti-mouse-CD62L, 1:150) and analyzed by flow cytometry
with over 1,000,000 events captured per sample.
[0117] Characterization of Ebola Glycoprotein-Specific Antibodies--
[0118] Flat bottom, Immulon 2HB plates (Fisher Scientific, Pittsburgh,
Pa.) were coated with purified Ebola virus GP.sub.33-637.DELTA.TM-HA (3
.mu.g/well) in PBS (pH 7.4) overnight at 4.degree. C. (Lee et al., 2009).
Heat-inactivated serum samples were diluted (1:20) in PBS. One hundred
microliters of each dilution were added to antigen-coated plates for 2
hours at room temperature. Plates were washed 4 times and incubated with
HRP-conjugated goat anti-mouse IgG, IgG1, IgG2a, IgG2b and IgM (1:2,000,
Southern Biotechnology Associates, Birmingham, Ala.) antibodies in
separate wells for 1 hour at room temperature. Plates were washed and
substrate solution added to each well. Optical densities were read at 450
nm on a microplate reader (Tecan USA, Research Triangle Park, N.C.).
[0119] Adenovirus Neutralizing Assay--
[0120] Heat-inactivated serum was diluted in twofold increments starting
from a 1:20 dilution. Each dilution was incubated with AdlacZ
(1.times.10.sup.6 pfu) for 1 hour at 37.degree. C. and applied to HeLa
cells (ATCC# CCL-2) seeded in 96-well plates (1.times.10.sup.4
cells/well). After this time, 100 .mu.l of DMEM supplemented with 20% FBS
were added to each well. Twenty-four hours later, beta-galactosidase
expression was measured by histochemical staining. Dilutions that reduced
transgene expression by 50% were calculated using the method of Reed and
Muench (reed et al., 1938). The absence of neutralization in samples
containing medium only (negative control) and FBS (serum control) and an
average titer of 1:1,280.+-.210 read from an internal positive control
stock serum were the criteria for qualification of each assay.
[0121] Statistical Analysis--
[0122] Data were analyzed for statistical significance using SigmaStat
(Systat Software Inc., San Jose, Calif.) by performing a one-way analysis
of variance (ANOVA) between control and experimental groups, followed by
a Bonferoni/Dunn post-hoc test when appropriate. Differences in the raw
values among treatment groups were considered statistically significant
when p<0.05.
Example 5
Characterization of Formulations
[0123] A variety of novel formulations were identified, prepared and
evaluated for their ability to maintain or improve transduction
efficiency of the adenovirus with minimal cytotoxicity in Calu-3 cells,
an in vitro model of the human respiratory epithelium (Ong et al., 2013).
Over 400 formulations were assessed using a recombinant adenovirus
expressing E. coli beta-galactosidase that differed from the inventors'
vaccine construct only by the transgene cassette. This virus was chosen
for these studies because it was available in sufficient quantity to
support the high-throughput screening approach used by the inventors and
for the ease by which the beta-galactosidase transgene product could be
visualized and quantitated in vitro and in vivo. Data summarized here
illustrate the inventors' heuristic approach where the number of
formulation candidates tested in vitro is significantly reduced prior to
the first in vivo screen for transduction efficiency and safety and
further reduced to a select few for characterization of the immune
response and subsequent evaluation of protection from lethal exposure to
rodent-adapted Ebola.
[0124] In Vitro Characterization of Formulated Adenovirus Preparations--
[0125] While many of the formulations included in the initial screen could
maintain the stability of the adenovirus at ambient temperatures (data
not shown), very few improved the in vitro transduction efficiency of the
virus above that seen from virus formulated in saline. However, a
preparation of 5% w/v sucrose increased transduction efficiency by a
factor of 1.96 with respect to virus formulated in saline (pH 7.4, FIG.
21A). Pluronic F68 (0.005% w/v), mannitol (1.25% w/v) and melezitose
(1.25% w/v) alone each increased transduction by a factor of 1.78, 1.61
and 1.51, respectively. Formulations consisting of either raffinose or
sorbitol alone at a 1.25% (w/v) concentration did not significantly
enhance transduction (p=0.06). A multi-component formulation, F3,
consisting of sucrose (10 mg/ml), mannitol (40 mg/ml) and 1% v/v
poly(ethylene) glycol 3,000, previously found to stabilize the virus at
ambient temperatures for extended periods of time (Renteria et al.,
2010), increased transduction fivefold (p=0.03). A formulation of 100
.mu.M nDMPS was the second most efficacious formulation, however,
significant cytoxicity (>80% cell lysis) was observed in cultures
treated with this formulation. Less than 1% lysis was observed in cells
treated with F3, making it suitable for further evaluation in vivo (data
not shown).
[0126] In an effort to improve transduction efficiency in the presence of
anti-adenovirus neutralizing antibodies, a method for encapsulation of
adenovirus with the bio-compatible polymer poly(lactic-co-glycolic acid)
was also developed (Choi et al., 2012). Only preparations that were
capable of releasing active virus at concentrations relevant for
immunization after storage at ambient temperatures would be considered
for further in vivo testing. Approximately 10.+-.0.43% of the virus
particles embedded in the polymer matrix were rendered uninfectious
during processing, leaving the average virus concentration to be
1.08.+-.0.5.times.10.sup.9 infectious virus particles (ivp) per milligram
of microspheres. Infectious virus particles were released for 14 days
after which virus could no longer be detected (FIG. 1B). Approximately
50% of the total amount of infectious virus embedded in freshly made
polymer beads and in beads stored at 25.degree. C. for 7 days was
released within 24 hours (FIG. 1C). Storage of the beads at room
temperature for 7 days did not significantly impact release rate as
1.34.times.10.sup.8 ivp were released per day from freshly prepared beads
and 1.76.times.10.sup.8 ivp released per day after this time. Storage at
room temperature for one month increased the rate of release to
3.5.times.10.sup.8 ivp/day and promoted release of the entire dose
(97.95%) within 48 hours (FIG. 1C).
[0127] In Vivo Transduction Efficiency of Formulated Adenovirus
Preparations in Naive Mice and Those with Pre-Existing Immunity--
[0128] Based upon their ability to improve transduction efficiency and
maintain virus stability, the F3 formulation and PLGA microspheres were
selected for further evaluation of their effect on the transduction
efficiency of adenovirus in naive mice and those with pre-existing
immunity (PEI) to adenovirus. PEGylated virus was also selected for
evaluation as a vaccine platform since the inventors have previously
shown that covalent attachment of poly(ethylene) glycol to the virus
capsid improves the transduction efficiency in animals that have been
exposed to adenovirus (Croyle et al., 2001). Intranasal administration of
AdlacZ, the model virus used for in vitro screening studies summarized in
FIGS. 1A-1C, in each respective formulation resulted in high levels of
transgene expression in epithelial cells of the conducting airways of
naive mice 4 days after treatment (FIGS. 2A-2D). More importantly, each
formulation significantly improved transgene expression in mice with
pre-existing immunity to adenovirus (FIGS. 2F-2H) with respect to
unformulated virus (FIG. 2E).
Example 6
Characterization of Immune Response
[0129] The T Cell Response: Magnitude--
[0130] Since the transduction efficiency data in mice with pre-existing
immunity to adenovirus looked promising for each formulation, the immune
response elicited by each formulation was evaluated in B10.Br mice with
the Ad-CAGoptZGP vector as described previously (Croyle et al., 2008;
Choi et al., 2012; Choi et al., 2013). The systemic antigen-specific T
cell response generated by each formulation candidate was evaluated by
quantitation of IFN-.gamma. secreting mononuclear cells (MNCs) in the
spleen by ELISpot. There was no significant difference in the amount of
antigen-specific cells present in samples obtained from naive animals
immunized with PEGylated, PLGA encapsulated or unformulated virus
(p>0.05, FIG. 3A). Samples from mice immunized with the F3 formulation
contained slightly more antigen-specific cells than those from mice given
unformulated vaccine (486.7.+-.4.8 spot-forming cells (SFCs)/million
MNCs, F3 vs. 414.7.+-.27.6 SFCs/million MNCs, Unform.). In contrast to
what was observed in naive animals, PEI significantly decreased the
number of activated IFN-.gamma. secreting MNCs in the spleens of animals
given each preparation except in those given the PEGylated vaccine
(317.3.+-.58.2 spot-forming cells (SFCs)/million mononuclear cells
(MNCs), naive vs. 234.7.+-.54.3 SFCs/million MNCs, PEI, FIG. 3A). The
most significant reduction in IFN-.gamma. secreting MNCs was observed in
animals given the microsphere preparation (426.7.+-.33.8 SFCs/million
MNCs, Naive vs. 57.3.+-.7.1 SFCs/million MNCs, PEI). Pre-existing
immunity also significantly reduced the number of IFN-.gamma. secreting
cells recovered from bronchioalveolar lavage (BAL) fluid in mice given
unformulated vaccine (1,513.3.+-.63.6 SFCs/million MNCs, naive vs.
526.7.+-.98.2 SFCs/million MNCs, PEI, p<0.01, FIG. 3B). This response
was not compromised in animals given the PEGylated and PLGA encapsulated
vaccines (PEG: 266.7.+-.54.6 SFCs/million MNCs, naive vs. 580.+-.61.1
SFCs/million MNCs, PEI; PLGA: 1280.+-.90.2 SFCs/million MNCs, naive vs.
1360.+-.231.8 SFCs/million MNCs, PEI).
[0131] The T Cell Response: Quality--
[0132] Both the quantity and quality of antigen-specific CD8.sup.+ T cells
induced by a vaccine platform significantly contribute to protection from
a variety of infectious diseases such as AIDS, malaria, and hepatitis C
(Fraser et al., 2013). In animal models of infection, the quality of the
antigen-specific T cell response can be assessed by stimulation of
splenocytes, intracellular staining and multi-parameter flow cytometry to
characterize the diversity of CD8.sup.+ T cell populations induced after
immunization (Zielinski et al., 2011). The presence of poly-functional
CD8.sup.+ T cells, capable of producing several cytokines (IFN-.gamma.,
IL-2, and TNF-.alpha.) in response to the antigen, has been found to
correlate with a reduction in circulating antigen and viral load since
they are known to be the most responsive cells early in the infection
process (Seder et al., 2008). Thus, strategies to increase the presence
of cells capable of producing variety of cytokines and chemokines in
response to a pathogen are part of many immunization strategies (Sallusto
et al., 2010; Coffman et al., 2010). In this context, functional analysis
of cytokine producing CD8.sup.+ T cells at the single-cell level was
performed to determine the ability of the formulations described herein
to improve the quality of the antigen-specific CD8.sup.+ T cell response.
As part of this analysis, the inventors were able to delineate seven
distinct cytokine-producing cell populations based upon IFN-.gamma.,
IL-2, and TNF-.alpha. secretion patterns.
[0133] As stated above, the relative frequency of cells that produce all
three cytokines defines the quality of the vaccine-induced CD8.sup.+ T
cell response. In naive mice, each formulation increased the number of
poly-functional CD8.sup.30T cells, with the PLGA encapsulated vaccine
producing the highest amount of these cells (IFN-.gamma..sup.+IL-2.sup.+
TNF-.alpha..sup.+, 37.1.+-.5.04%, FIG. 3C). Prior exposure to adenovirus
in the nasal mucosa reduced the quality of the response generated by the
unformulated vaccine (23.9.+-.3.24%, Naive vs. 19.1.+-.6.76%, PEI) and F3
(27.2.+-.4.60%, Naive vs. 14.8.+-.2.85%, PEI) while the response induced
by the PEGylated vaccine was not compromised (24.8.+-.3.69%, Naive vs.
26.9.+-.4.74%, PEI, FIG. 3D). The poly-functional response was somewhat
strengthened in mice with prior exposure to adenovirus given the PLGA
microspheres (37.1.+-.5.04%, Naive vs. 41.7.+-.7.88%, PEI). This effect
was also seen 42 days after immunization.
[0134] The T Cell Response: Memory--
[0135] Antigen-specific CD8.sup.+ memory T cells are crucial components of
long-term protection against viral infections. In order to predict the
long-term efficacy of the formulated vaccines of the invention, the
inventors evaluated the effector memory CD8.sup.+ T cell response with a
CFSE proliferation assay. Forty-two days after immunization, splenocytes
isolated from naive mice given the unformulated vaccine contained
8.8.+-.1.02% effector memory CD8.sup.+ T cells capable of proliferating
in response to an Ebola virus glycoprotein-specific MHC I-restricted
peptide (FIG. 3E). The number of effector memory CD8.sup.+ T cells was
lower in samples harvested from animals immunized with the other
formulations. Prior exposure to adenovirus significantly reduced the
memory response in mice given the F3 formulation, PEGylated and
unformulated vaccine. The response elicited by PLGA encapsulated vaccine
was suppressed by pre-existing immunity to a lesser degree than that
observed in the other treatment groups (2.32.+-.0.09% vs. 0.85.+-.0.08,
F3 vs. 0.72.+-.0.04, PEG).
[0136] The Anti-Ebola Virus Antibody Response--
[0137] The inventors have previously found that prior exposure to
adenovirus significantly reduced antibody-mediated immune response to
Ebola glycoprotein in mice and guinea pigs (Choi e al., 2013). More
specifically, the inventors also found that a reduction in
glycoprotein-specific IgG1 antibodies correlated with poor survival after
challenge with rodent-adapted Ebola. Thus, the inventors evaluated total
anti-Ebola glycoprotein-specific immunoglobulin (IgG) and IgG isotypes in
serum to determine if each formulation could counterbalance the effect of
prior mucosal exposure to adenovirus on B cell-mediated immune responses
(FIGS. 4A-4B). Each formulation significantly increased the amount of
each antibody isotype specific for Ebola glycoprotein (GP) in naive mice
(FIG. 4A). IgG2a levels in mice given PLGA microspheres was the only
deviation from this trend as it was reduced by 29.9% with respect to
unformulated virus (FIG. 4A). Prior exposure to adenovirus significantly
reduced each anti-Ebola GP-specific IgG isotype evaluated (FIG. 4B).
Although IgG2b levels in samples collected from mice immunized with the
F3 formulation doubled, IgG1 and IgG2a levels were not significantly
different from that seen in animals given unformulated virus. IgG1 and
IgG2b levels in mice immunized with PLGA microspheres were 9.5 and 1.3
times that found in samples from mice given unformulated vaccine (FIG.
4B). PEI to adenovirus reduced IgG2b levels by 45.9% in mice given
PEGylated vaccine. IgG1 and IgG2a could not be detected in serum of mice
immunized with this preparation. Trace levels of Ebola GP-specific IgM
antibodies were found in serum from mice given the PLGA and PEGylated
preparations.
[0138] Survival From Lethal Challenge--
[0139] A marked reduction in the quality of the T cell response and in Th2
type antibody responses were found to be indicative of poor protection
against lethal infection with Ebola virus in animals with PEI to
adenovirus (Choi et al., 2013). Using this criteria, the inventors
decided that mice immunized with vaccine in formulation F3 would not be
subject to challenge with a lethal dose of a mouse-adapted variant of
Ebola (MA-EBOV) since neither facet of the immune response was notably
improved by the formulation in mice with PEI to adenovirus. All of the
naive mice given unformulated vaccine and the PLGA microsphere
preparation survived lethal challenge with MA-EBOV (1,000
pfu.apprxeq.30,000.times.LD.sub.50, FIG. 5A). Twenty five percent of
naive mice given the PEGylated vaccine succumbed to infection. Sixty
percent of the animals with PEI to adenovirus that were immunized with
unformulated vaccine survived challenge. Eighty percent of mice with
prior exposure to adenovirus that were immunized with the PEGylated
preparation did not survive challenge. This group also demonstrated the
most notable drop in body weight during the course of infection (FIG.
5B). Samples taken from this group also revealed sharp elevations in ALT
(842.+-.342 U/L) and AST (602.+-.298 U/L), indicative of severe liver
damage from infection (FIG. 5C). The PLGA microsphere preparation
protected 80% of the mice with PEI to adenovirus from challenge. Serum
ALT (195.+-.7.25 U/L) and AST (232.+-.10.1 U/L) levels were significantly
lower in this treatment group with respect to those from animals given
only saline (ALT 1,913.6.+-.228.6 U/L; AST 2,152.+-.394.77 U/L) for which
the challenge was uniformly lethal and from mice with PEI given
unformulated vaccine (ALT: 879.+-.197 U/L; AST: 898.+-.241 U/L,
p<0.01).
Example 7
An In Vitro Assay for Quantitative Evaluation of Transduction Efficiency
of Formulated Virus in the Presence of Neutralizing Antibodies
[0140] Because the PLGA and PEGylated preparations did not fully protect
mice with PEI to adenovirus from lethal challenge, a secondary effort to
identify formulations to improve survival was initiated. Based upon the
initial results with the maltoside, nDMPS, the inventors sought to
identify compounds with similar properties but reduced toxicity profiles
for further testing. Evaluation of transduction efficiency in the
presence of neutralizing antibody was also included as a more stringent
test to predict in vivo performance of formulation candidates. Three
different amphiphols, differing only in the length of carbon chain in the
hydrophobic region of the molecule were first evaluated for their ability
to preserve the transduction efficiency of the model AdlacZ vector in
Calu-3 cells in the presence of neutralizing antibodies. Transduction
efficiency of the virus in a formulation of 10 mg/ml of poly (Maleic
Anhydride-alt-1-Decene) substituted with 3-(Dimethylamino) Propylamine
(referred to as F8) was reduced from 2.58.+-.0.03.times.10.sup.7 to
1.94.+-.0.14.times.10.sup.7 ivp/ml when the anti-adenovirus 5 antibody
concentration in the infection media increased from 0.5 N.D..sub.50 to 5
N.D..sub.50 (FIG. 6A). Virus formulated with 10 mg/ml poly (Maleic
Anhydride-alt-1-Tetradecene) substituted with 3-(Dimethylamino)
Propylamine (F12) experienced the most significant drop in transduction
efficiency when antibody concentration was increased from 0.5 N.D..sub.50
to 5 N.D..sub.50 (74% reduction, 1.64.+-.0.18.times.10.sup.7 (0.5
N.D..sub.50), to 4.28.+-.0.48.times.10.sup.6 (5 N.D..sub.50) lfu/ml).
Transduction efficiency of the virus formulated with 10 mg/ml poly
(Maleic Anhydride-Alt-1-Octadecene) substituted with 3-(Dimethylamino)
Propylamine (F16) in the presence of 5 N.D..sub.50 neutralizing antibody
was not significantly different from that in the presence of the 0.5
N.D..sub.50 concentration (p=0.08, FIG. 6A). This compound also had a
very favorable toxicity profile as formulations of 1 and 10 mg/ml were
cytotoxic to only 1.9.+-.0.47 and 1.8.+-.0.61% of the Calu-3 cell
population respectively (FIG. 6B). Increasing the concentration to five
times that of the effective concentration (50 mg/ml) was still well
tolerated by the Calu-3 cell monolayer with 3.63.+-.0.35% lysis noted.
[0141] Before the vaccine formulated with the F16 preparation was tested
in vivo, it underwent an additional round of screening to confirm that
transduction efficiency was adequately improved in the presence of
neutralizing antibody. In order to increase the sensitivity of this assay
and make it a better predictor of in vivo performance, the inventors
decided to incorporate a model a recombinant adenovirus 5 vector
expressing green fluorescent protein (AdGFP) into the test formulations
and evaluate transduction efficiency by fluorescence-activated cell
sorting (FACS). In order to generate data that was clinically relevant,
the assay was the virus was incubated with five different solutions
containing a series of neutralizing antibody concentrations spanning
those found in the general population.sup.28,41. Cells infected with the
virus were quantitated by flow cytometry 48 hours after infection. While
8.58% of the monolayer infected with unformulated virus expressed the
transgene, the F16 formulation increased transduction efficiency to 38.8%
(FIG. 6C). This assay allowed the inventors to see significant
differences in transduction efficiency of the formulated virus in the
presence of the 0.5 N.D..sub.50 and 5 N.D..sub.50 antibody concentrations
that was not detected by the infectious titer assay (3.44%, 0.5
N.D..sub.50, vs. 34.4%, 5 N.D..sub.50). Although the formulation improved
transduction efficiency of the virus over a wide range of antibody
concentrations, the limit of this improvement was reached at the 50
N.D..sub.50 concentration where the formulation could no longer protect
the virus from neutralization.
[0142] Adenovirus formulated with the F16 compound was well tolerated in
naive animals and those with PEI to adenovirus. Almost every epithelial
cell in both large and small airways was transduced by virus formulated
with F16 (FIG. 6D). Highly concentrated areas of transgene expression
were also found in small airways of mice with circulating neutralizing
antibody levels of 262.+-.43 reciprocal dilution given virus in this
formulation. In contrast, PEI to adenovirus prevented transgene
expression in both large and small airways of mice given unformulated
virus. Serum transaminases, standard indicators of adenovirus
toxicity.sup.42, in both naive animals and those with PEI to adenovirus
immunized with the F16 formulation were reduced by 40% with respect to
similar treatment groups given unformulated vaccine (data not shown).
Example 8
The Immune Response Generated by Formulation F16 in Mice with Pre-Existing
Immunity
[0143] Because prior formulation candidates did not fully confer
protection in mice in which PEI was established through the nasal mucosa,
evaluation of the F16 formulation in vivo focused solely on the ability
of this formulation to improve the immune response to the encoded Ebola
glycoprotein under these specific conditions. As seen in prior studies,
PEI significantly compromised the production of GP-specific
IFN-.gamma.-secreting mononuclear cells isolated from spleen (FIG. 7A)
and BAL fluid (FIG. 7B) in animals given unformulated vaccine
(p<0.01). PEI induced by the mucosal route also significantly reduced
the frequency of GP-specific multifunctional CD8.sup.+ T cells elicited
by the unformulated vaccine (Naive: 64.9.+-.4.88% vs. IN
PEI/Unformulated: 48.6.+-.3.66%, p<0.05; FIG. 7C).
[0144] The F16 formulation improved the immune response in animals with
PEI to adenovirus as the number of GP-specific, IFN-.gamma.-secreting
mononuclear cells isolated from the spleen of these animals was notably
higher than that from naive animals given unformulated vaccine
(2,290.+-.51 SFCs/million MNCs, naive vs. 2,840.+-.110 SFCs/million MNCs,
PEI/F16, p<0.05, FIG. 7A). The number of antigen-specific
IFN-.gamma.-secreting mononuclear cells isolated from the BAL fluid of
animals given the F16 formulation was not statistically different from
that found in naive animals given unformulated vaccine (p=0.07, FIG. 7B).
This trend was also observed with respect to the multifunctional
CD8.sup.+ T cell response as it also did not change with respect to that
found in naive animals given unformulated vaccine (Naive/unformulated:
64.9.+-.4.88% vs. IN PEI/F16 (10 mg/ml): 60.0.+-.9.1%, p=0.055; FIG. 7C).
Forty-two days after immunization, the effector memory CD8.sup.+ T cell
response was also evaluated in mice immunized with unformulated vaccine
or the F16 preparation. The F16 formulation increased the memory response
by a factor of 3.3 from 0.28.+-.0.15% (unformulated) to 0.93.+-.0.25%
(F16, data not shown). Serum from animals with pre-existing immunity to
adenovirus that were immunized with the F16 preparation contained 4 times
more anti-Ebola glycoprotein antibodies than that from animals given
unformulated vaccine (FIG. 8). Samples from these animals also contained
5 times more of the IgG1 isotype and notable levels of antigen-specific
IgM antibodies.
Example 9
Materials and Methods for Primate Studies (Examples 10-11) Adenovirus
Production
[0145] The E1/E3 deleted recombinant adenovirus serotype 5 vector
expressing a codon optimized full-length Ebola glycoprotein sequence
under the control of the chicken .beta.-actin promoter (Ad-CAGoptZGP) and
a host range mutant adenovirus serotype 5 (Ad5MUT) that can replicate in
non-human primates were amplified in HEK 293 cells and purified as
described (Richardson et al., 2009; Buge et al., 1997). Concentration of
each virus preparation was determined by UV spectrophotometric analysis
at 260 nm and with the Adeno-X Rapid Titer Kit (Clontech, Mountain View,
Calif.) according to the manufacturer's instructions. Preparations with
infectious to physical particle ratios of 1:37 were used in these
studies. Buffers and reagents used in the production and purification of
each virus preparation were of the highest quality available and were
tested for the presence of endotoxin using a QCL-1000 Chromogenic LAL end
point assay (Cambrex Bioscience, Walkersville, Md.). All reagents
contained less than 0.1 E.U./mL, and each virus preparation contained
less than 0.2 E.U./mL. Sterility of each preparation was confirmed
employing the methods outlined in the United States Pharmacopeia for
parenteral products. (Sterility Tests. In the United States Pharm., 2014)
[0146] Assay for Detection of Replication Competent Adenovirus (RCA)
[0147] A two cell line bioassay was performed on each preparation to
determine the presence of RCA as described (Gilbert et al., 2014). Less
than one RCA was detected for every 3.times.10.sup.12 virus particles
tested.
[0148] Animal Model
[0149] Non-human primate studies were conducted under a contract at
Bioqual Inc., Gaithersburg, Md. The animal management program of this
institution is accredited by the American Association for the
Accreditation of Laboratory Animal Care and meets NIH standards as
outlined in the Guide for the Care and Use of Laboratory Animals. This
institution also accepts as mandatory PHS policy on Humane Care of
Vertebrate Animals used in testing, research, and training. Twenty male
cynomolgus macaques (Macaca fascicularis) of Chinese origin were allowed
to acclimate for 30 days in quarantine prior to immunization. Animals
received standard monkey chow, treats, vegetables, and fruits throughout
the study. Husbandry enrichment consisted of commercial toys and visual
stimulation. Two separate experiments were conducted as summarized in
FIGS. 10 and 16A-16B. Specific details about the primates used in each of
these studies are summarized in Tables 1 and 2.
TABLE-US-00001
TABLE 1
Primate Study 1: Primate Characteristics and Treatment
animal wt dose route of age
no. treatment (kg) (ivp/kg) admin (years)
22457 KPBS 8.05 IM 10
22473 Ad- 6.36 1.6 .times. 10.sup.8 IM 10
CAGoptZGP
40347 Ad- 6.16 1.6 .times. 10.sup.8 IM 8
CAGoptZGP
50459 Ad- 7.31 1.4 .times. 10.sup.9 IN/IT 7
CAGoptZGP
52483 Ad- 6.98 1.4 .times. 10.sup.9 IN/IT 7
CAGoptZGP
52945 Ad- 6.84 1.5 .times. 10.sup.9 IN/IT 7
CAGoptZGP
52165 Ad- 6.30 1.6 .times. 10.sup.9 SL 7
CAGoptZGP
62125 Ad- 5.59 1.8 .times. 10.sup.9 SL 6
CAGoptZGP
62361 Ad- 6.38 1.6 .times. 10.sup.9 SL 6
CAGoptZGP
TABLE-US-00002
TABLE 2
Primate Study 2: Primate Characteristics and Treatment
animal wt dose route of age
no. treatment (kg) (ivp/kg) admin (years)
0810091 KPBS 8.7 IM 6
0805201 KPBS 6.8 IM 6
0802197 Ad- 6.2 1.6 .times. 10.sup.9 IN/IT 6
CAGoptZGP
0809077 Ad- 6.5 1.5 .times. 10.sup.9 IN/IT 6
CAGoptZGP
0810003 Ad- 5.8 1.7 .times. 10.sup.9 IN/IT 6
CAGoptZGP
0805257 Ad- 4.9 2.0 .times. 10.sup.10 SL 6
CAGoptZGP
0804317 Ad- 4.8 2.0 .times. 10.sup.10 SL 6
CAGoptZGP
0808233 Ad- 4.8 2.0 .times. 10.sup.10 SL 6
CAGoptZGP
0809227 Ad5MUT 5.5 1.8 .times. 10.sup.10 IM 6
Ad- 1.8 .times. 10.sup.10 SL
CAGoptZGP
0804819 Ad5MUT 5.2 1.9 .times. 10.sup.10 IM 6
Ad- 1.9 .times. 10.sup.10 SL
CAGoptZGP
0807243 Ad5MUT 4.9 .sup. 2 .times. 10.sup.10 IM 6
Ad- .sup. 2 .times. 10.sup.10 SL
CAGoptZGP
[0150] Primate Study 1 (Results Shown in Example 10)
[0151] The first study was conducted with 9 primates. Two animals were
given the vaccine by intramuscular injection in a total volume of 1 mL of
potassium phosphate buffered saline (KPBS) divided equally between the
left and right deltoid muscles. Three animals were given the vaccine by
the sublingual route by placing 50 .mu.L of the preparation under each
side of the tongue and waiting for 15 min between doses to allow for
absorption. Three animals were given the vaccine in the respiratory
tract. This was achieved by slowly dispensing two 250 .mu.L volumes of
the preparation into each nostril and waiting for 15 min between doses to
allow for absorption. The remaining dose of the vaccine (5 mL volume) was
instilled into the lungs via an endotracheal tube. This route of
administration will be referred to as respiratory immunization or as
intranasal/intratracheal (IN/IT) throughout the manuscript to illustrate
that the vaccine was administered to the respiratory mucosa by two
different routes. One primate was given 1 mL of KPBS divided equally
between the left and right deltoid muscles. This animal was the negative
control. Blood was collected 6 h after immunization and on days 1, 2, and
7. Full blood chemistry panels and complete blood counts were performed
by IDEXX BioResearch (West Sacramento, Calif.).
[0152] Primate Study 2 (Results Shown in Example 11)
[0153] A second study was conducted with 11 primates. Two animals
(negative controls) were given 1 mL each of KPBS divided between the left
and right deltoid muscles. The respiratory formulation contained sucrose
(10 mg/ml), mannitol (40 mg/ml) and 10 mg/mL poly(maleic
anhydride-alt-1-octadecene) substituted with 3-(dimethylamino)propylamine
and administered as a solution to the respiratory mucosa of three animals
as described for study 1. Three animals were given an adenovirus serotype
5 host range mutant virus to establish pre-existing immunity (PEI) by IM
injection 28 days prior to immunization with the vaccine by the
sublingual route as described above. Three animals with no prior exposure
to adenovirus were given the vaccine by the sublingual route for
comparison.
[0154] Challenge
[0155] Animals were transported to the National Microbiology Laboratory in
Winnipeg and, after an acclimation period, transferred to the biosafety
level 4 (BSL-4) laboratory there for challenge. Challenge studies were
approved by the Canadian Science Centre for Human and Animal Health
(CSCHAH) Animal Care Committee following the Guidelines of the Canadian
Council on Animal Care. For challenge, animals were infected by
intramuscular injection at two sites with a total volume of 1 mL of
freshly prepared Ebola virus (strain Kikwit 95, passage 3 on VeroE6
cells) of an inoculum containing 1,000 times the 50% tissue culture
infectious dose (TCID50) in diluent (minimal essential medium containing
0.3% bovine serum albumin). Ebola virus titers were confirmed
(1.21.times.103 TCID50/mL) by back-titration of the challenge preparation
following administration of the virus. Animals were monitored daily and
scored for disease progression using an internal filovirus scoring
protocol approved by the CSCHAH Animal Care Committee. The scoring system
graded changes from normal in the subject's posture, attitude, activity
level, feces/urine output, food/water intake, weight, temperature, and
respiration and ranked disease manifestations such as a visible rash,
hemorrhage, cyanosis, or flushed skin. Samples were taken for assessment
of anti-Ebola GP antibodies and full blood panels on days 3, 7, 14, 21,
and 28 postchallenge and upon death. Hematological analysis of samples
was performed in the BSL-4 lab with a Horiba ABX Scil ABC Vet Animal
Blood Counter, and blood chemistries were analyzed with a VetScan vs1
(Abraxis). Surviving animals were kept until day 28.
[0156] ELISpot Assay
[0157] IFN-.gamma. ELISpot assays were performed in triplicate according
to the manufacturer's protocol (BD Biosciences, San Diego, Calif.) with
5.times.105 peripheral blood mononuclear cells (PBMCs) per well in cRPMI
media (RPMI 1640, 1 mM 1-glutamine, 50 .mu.M .beta.-mercaptoethanol, 10%
FBS and 1% penicillin/streptomycin). Cells were stimulated with three
peptide pools for the Ebola glycoprotein (2.5 .mu.g/mL) for 18 h. Spots
were visualized with the AEC substrate (BD Biosciences) and quantified
with the ELISpot Plate Reader (AID Cell Technology, Strassberg, Germany).
[0158] Intracellular Cytokine Staining
[0159] PBMCs were isolated from whole blood collected prior to challenge
as described (Qiu et al., 2013). The frequency of CD8+ and CD4+ T cells
producing IFN-.gamma., IL-2, IL-4, and CD107a were assessed by flow
cytometry with the following antibodies: CD3 Alexa Fluor 700 (clone
SP34-2) and CD4 Peridinin Chlorophyll Protein (PerCP)-Cy5.5 (clone L200)
from BD Biosciences (San Jose, Calif.); CD8 phycoerythrin (PE)-Cy7 (clone
RPA-T8), CD107a Brilliant Violet 421 (clone H4A3), L-2 Alexa Fluor 488
(clone MQ1-17h12), IL-4 PE (clone 8D4-8), and IFN-.gamma. Allophycocyanin
(APC, clone B27) from BioLegend (San Diego, Calif.). One million PBMCs
were stimulated overnight with peptides (5 .mu.g/mL) using GolgiPlug (0.5
.mu.L/mL) and GolgiStop (0.6 .mu.L/mL) in the presence of the anti-CD107a
antibody. After surface staining for CD3, CD4, and CD8, samples were
incubated two times (30 min each) in Cytofix/Cytoperm (BD Biosciences)
for permeabilization. Intracellular staining was performed, and the
samples were kept overnight in PBS/1% paraformaldehyde. Approximately
250,000-500,000 events were captured on a BD LSR II flow cytometer and
data analyzed with FlowJo vX0.6 software (Tree Star, Ashland, Oreg.).
[0160] Measurement of Proliferative Responses by Ki-67 Staining
[0161] Blood was collected from each primate in EDTA tubes, shipped same
day and PBMCs isolated as described previously (Hokey et al., 2008).
Cells were resuspended in R10 medium (RPMI 1640, 2 mM 1-glutamine, 50
.mu.M 3-mercaptoethanol, 10% FBS, and 100 IU/mL penicillin and
streptomycin) and stimulated using either an Ebola glycoprotein-specific
peptide library (2.5 .mu.g/mL), a first generation adenovirus that is
genetically identical to the vaccine but does not contain a transgene
cassette (AdNull, 1,000 MOI),(22) or 5 .mu.g/mL ConA (Sigma, St. Louis,
Mo.) for 5 days in 5% CO2 at 37.degree. C. After 3 days, cells were fed
by removing 50 .mu.L of spent medium and replacing it with 100 .mu.L of
fresh R10 medium. On day 5, cells were washed with phosphate buffered
saline (PBS) for subsequent immunostaining for cell surface markers and
for Ki-67, an intracellular marker for proliferation as described
(Shedlock et al., 2010). Proliferation was calculated by subtraction of
values obtained from cells cultured in medium alone.
[0162] Anti-Ebola Glycoprotein Antibody ELISA
[0163] Flat bottom, Immulon 2HB plates (Fisher Scientific, Pittsburgh,
Pa.) were coated with purified Ebola virus GP33-637.DELTA.TM-HA (3
.mu.g/well) in PBS (pH 7.4) overnight at 4.degree. C. (Lee et al., 2009).
Heat-inactivated serum samples were diluted (1:20) in saline. One hundred
microliters of each dilution were added to antigen-coated plates for 2 h
at room temperature. Plates were washed 4 times and incubated with a
HRP-conjugated goat anti-monkey IgG antibody (1:2,000, KPL, Inc.,
Gaithersburg, Md.) for 1 h at room temperature. Plates were washed and
substrate solution added to each well. Optical densities were read at 450
nm on a microplate reader (Tecan USA, Research Triangle Park, N.C.).
[0164] Neutralizing Antibody Assays
[0165] Ebola Virus
[0166] Primate sera were heat inactivated at 56.degree. C. for 45 min and
then serially diluted in 2-fold increments in Dulbecco's modified Eagle's
medium (DMEM) in triplicate prior to incubation at 37.degree. C. for 1 h
with an equal volume of medium containing EBOV-eGFP (100 PFU per well) as
described (Qiu et al., 2012). Virus-serum mixtures were then added to
Vero E6 cells and placed at 37.degree. C. for 2 days and then fixed in
10% phosphate buffered formalin. GFP levels were quantified by a
fluorescent plate reader (AID Cell Technology). These assays were
performed under BSL-4 conditions at the National Microbiology Laboratory
in Winnipeg.
[0167] Adenovirus
[0168] Primate sera were heat inactivated and serially diluted as
described for the Ebola virus assay. Samples were incubated with a first
generation adenovirus serotype 5 expressing beta-galactosidase for 1 h
before they were added to HeLa cell monolayers. An equal volume of medium
containing 20% FBS was then added to each well, and infections continued
for 24 h. Cells were then histochemically stained for beta-galactosidase
expression as described (Choi et al., 2012). Positive cells were
quantified by visual inspection with a Lecia DM LB microscope (Leica
Microsystems Inc., Bannockburn, Ill.). For both assays, the serum
dilution that corresponded to a 50% reduction in transgene expression was
calculated by the method of Reed and Muench and reported as the
reciprocal of this dilution (Reed et al., 1938).
[0169] Quantification of Virus Genomes by Real Time PCR
[0170] Ebola Virus
[0171] Total RNA was extracted from whole blood using a QIAmp Viral RNA
Mini Kit (Qiagen). Ebola virus RNA was detected by a qRT-PCR assay
targeting the RNA polymerase (nucleotides 16472 to 16538, AF086833) and
LightCycler 480 RNA Master Hydrolysis Probes (Roche Diagnostics GmbH,
Mannheim, Germany). The reaction conditions were as follows: 63.degree.
C. for 3 min, 95.degree. C. for 30 s, and cycling of 95.degree. C. for 15
s, 60.degree. C. for 30 s for 45 cycles with a LightCycler 480 II
(Roche). Primer sequences for this assay were as follows: EBOVLF2
CAGCCAGCAATTTCTTCCAT (SEQ ID NO: 3), EBOVLR2 TTTCGGTTGCTGTTTCTGTG (SEQ ID
NO: 4), and EBOVLP2FAM FAM-ATCATTGGCGTACTGGAGGAGCAG-BHQ1 (SEQ ID NO: 5).
[0172] Adenovirus
[0173] Urine and BAL fluid were concentrated using Amicon Ultra 100K
Centrifugal Filter Devices (Millipore, Billerica, Mass.). DNA was
isolated from blood, concentrated BAL, and oral and nasal swabs using a
QIAmp DNA Mini kit according to the manufacturer's instructions (Qiagen,
Valencia, Calif.). DNA was isolated from rectal swabs using a modified
protocol and the QIAmp DNA Mini kit. DNA was extracted from the urine
concentrate using a QIAamp Viral RNA mini kit (Qiagen) according to the
manufacturer's instructions. DNA was isolated from stool samples using a
QIAamp Fast DNA Stool Mini kit (Qiagen). Quantification of viral DNA was
determined by real time PCR according to a published protocol (Callahan
et al., 2006). DNA amplifications were carried out using a ViiA 7
Real-Time PCR System (Life Technologies, Carlsbad, Calif.) with the
following cycling conditions: 50.degree. C. for 2 min, 95.degree. C. for
10 min, 95.degree. C. for 15 s, and 62.degree. C. for 1 min for a total
of 41 cycles. Primer sequences, used to amplify a region of the
adenovirus serotype 5 hexon protein, were 5'-ACT ATA TGG ACA ACG TCA ACC
CAT T-3' (forward: SEQ ID NO: 6) and 5'-ACC TTC TGA GGC ACC TGG ATG T-3'
(reverse; SEQ ID NO: 7). The internal probe sequence, tagged with 6FAM
fluorescence dye at the 5' end and TAMRA quencher at the 3' end, was
5'-ACC ACC GCA ATG CTG GCC TGC-3' (SEQ ID NO: 8). Each sample was run in
triplicate in a given PCR assay.
Example 10
Results of Primate Study 1
[0174] The first primate study, referred to as Primate Study 1, involved 9
male cynomolgus macaques and served to identify suitable doses of vaccine
that were semiprotective for further evaluation of test formulations to
improve survival in the NHP model. The workflow and treatment schedules
for the study are depicted in FIGS. 10 and 16A-16B.
[0175] Administration of the vaccine at a dose of 1.4.times.10.sup.9
infectious virus particles (ivp)/kg to the respiratory and the sublingual
mucosa was well tolerated with no adverse reactions noted. Of particular
note is that all animals experienced a transient increase in serum
phosphate levels 6 h after immunization with a primate from each
treatment group falling outside normal values (22473, IM, 1.4 times
normal, 50459, IN/IT, 1.2 times normal, 62125, SL, 1.3 times normal, FIG.
11A). Phosphate levels for all animals reached their nadir at the 24 h
time point and were within the normal range for the remainder of the
study. Blood urea nitrogen (BUN) levels peaked for all animals 24 h after
immunization. Two of these animals, one given the vaccine by IM injection
(40347, 29 mg/dL) and another given the vaccine by the IN/IT route
(52945, 33 mg/dL), had levels that were notably outside of the normal
range (FIG. 11B). These values returned to normal by 48 h and remained so
throughout the course of the study. Serum aspartate aminotransferase
(AST), a standard indicator of adenovirus toxicity, (29) was
significantly elevated above normal values in all animals 24 h after
immunization except for one animal given the vaccine by the SL route
(62125) and another given the vaccine by the IM route (40347). AST levels
fell 48 h after immunization with only a few animals remaining above
normal limits (FIG. 11C). AST values for all animals were within normal
limits by the 7 day time point. Serum alkaline phosphatase (ALP) of two
animals fell outside the normal range during the study. Samples from one
animal given the vaccine by IM injection were only mildly over the normal
acceptable limit (22473, FIG. 11D) while those of an animal immunized by
the IN/IT route (52945) were 2 times the normal acceptable limit. In both
cases, this parameter was high throughout the study and this elevation
was not in response to the vaccine. Other serological parameters
evaluated during the first week after immunization (calcium, creatinine,
albumin, globulin, total protein, total bilirubin, alanine
aminotransferase (ALT), glucose, sodium, potassium, chloride, and
cholesterol) all fell within normal limits during the course of the
study.
[0176] Adenovirus shedding was also evaluated using a standard real time
PCR assay to detect adenovirus genomes(28) in serum, nasal swabs, BAL
fluid, oral swabs, urine, and feces (FIGS. 12A-12F). A significant number
of adenovirus genomes were found in the serum of one animal immunized by
the respiratory route 2 days after immunization (50459, 1,452 genomes/mL
serum, FIG. 12A) and another immunized by IM injection 7 days after
treatment (22473, 7,296 genomes/mL serum). As expected, substantial
amounts of adenovirus serotype 5 genomes were found in nasal swabs
obtained from primates immunized by the IN/IT route (50459,
4.2.times.106, 52483, 1.4.times.106, 59245, 7.5.times.105) 24 h after
immunization (FIG. 12B). Swabs from one primate immunized by the SL route
also contained a notable amount of Ad5 genomes (62361, 8,090) at the 24 h
time point. Swabs from one animal immunized by the IN/IT route contained
a significant amount of adenovirus genomes 2 days after immunization
(52945, 6,333). Samples taken at days 7 and 20 fell below detection
limits of the assay. Very low amounts of Ad5 genomes were found in the
BAL fluid of animals immunized by the IN/IT route 20 days after
immunization (FIG. 12C). Oral swabs taken 24 h after treatment from one
NHP immunized by the IN/IT route (52483, 4.5.times.10.sup.4, FIG. 12D)
and two animals immunized by the SL route (62125, 4.9.times.10.sup.4, and
62361, 9.3.times.10.sup.4) contained significant numbers of adenovirus
genomes. Swabs collected from animals at the 2 day time point did not
contain any adenovirus genomes. A significant number of virus genomes
were detected in the urine of 2 animals within 6 h after treatment
(52945, 621 copies/mL, and 62361, 1,228 copies/mL). Adenovirus DNA was
also found 24 h after treatment in the urine of 3 animals (50459, 1,163,
62361, 801, and 62125, 116 copies/mL, FIG. 12E). Samples from all other
animals throughout the time course of this study fell below detection
limits of the assay. Interestingly, adenovirus genomes were only detected
in the feces of animals immunized by the IN/IT route (FIG. 12F). As early
as 6 h after immunization, 2,362 and 7,302 adenovirus genomes were found
in fecal samples from animals 52483 and 52945 respectively. Feces
collected from animal 50459 24 h after vaccination contained 5,919
adenovirus genomes. This increased to 7,405 in samples taken from the
same animal at the 48 h time point. Samples from animal 52945 also taken
48 h after treatment contained 2,772 virus genomes.
[0177] The T Cell Response
[0178] Twenty days after immunization, PBMCs were isolated from whole
blood and incubated with peptides specific for Ebola glycoprotein (GP).
Cells were then subjected to intracellular cytokine staining for CD8+ and
CD4+ surface antigens and IFN-.gamma. and sorted by flow cytometry. At
this time point, few cells responsive to Ebola glycoprotein could be
detected in PBMCs obtained from any of the animals (data not shown). A
similar trend was observed in samples taken from iliac lymph nodes (ILNs)
of animals. Profound responses were seen in samples obtained from the BAL
fluid of animals given the vaccine by the IN/IT route. The strongest
response was seen in CD4+ cells with 12.5% of the population obtained
from primate 52945 and 3.03% of the population from primate 50459
responding (FIG. 13A). Although the response from the third primate in
this treatment group (52483) was small in comparison (0.71%), it was
significantly higher than that observed in animals given the vaccine by
IM injection. The CD8+ T cell response followed a similar trend (FIG.
13B).
[0179] PBMC and ILN populations were further analyzed for IFN-.gamma.
production in response to Ebola GP by ELISpot. Samples from animals
immunized by the IM route (22473 and 40347) both had significant numbers
of IFN-.gamma. producing cells (255 and 642 spot forming cells
(SFCs)/million mononuclear cells (MNCs) respectively, FIG. 13C). PBMC
samples from two NHPs immunized by the SL route (52165, 62361) also had
measurable numbers of IFN-.gamma. producing cells (257 and 98
SFCs/million MNCs). Samples from NHPs immunized by the IN/IT route
contained the highest numbers of IFN-.gamma. producing cells (1,100, 607,
and 2,055 SFCs/million MNCs). Samples from the ILNs of 2 NHPs given the
vaccine by the IN/IT route (50459 and 52945) contained approximately 7
and 18 times the number of IFN-.gamma. producing cells found in the
saline control (animal 22457) respectively (FIG. 13D).
[0180] 38 days after immunization, the proliferative capacity of CD4+ and
CD8+ cells in response to Ebola GP and adenovirus serotype 5 was assessed
by a Ki-67 staining assay (Shedlock et al., 2010). Two samples, each
obtained from animals immunized by the respiratory route, contained
significant numbers of proliferative Ebola GP-specific CD4+ T cells
(50459, 11.9%, and 52945, 6.5%, white bars, FIG. 13E). The sample
obtained from NHP 50459 also contained the most Ebola GP-specific CD8+ T
cells (8.8%, black bars, FIG. 13E). The sample from NHP 62125 immunized
by the SL route contained the second highest amount of CD8+ T cells
(4.9%). All remaining samples contained approximately 3-4% CD8+ T cells
that could proliferate in response to Ebola GP except for that from
animal 52483 (1.1%). Only one sample obtained from a primate immunized by
the IN/IT route, 52165, contained a significant population of
proliferative adenovirus 5-specific CD4+ T cells (8.1%, white bars, FIG.
13F). One sample from a primate in the IN/IT group (50459) and another
from the SL group (62125) contained notable populations of CD8+ cells
that proliferated in response to Ad5 (9.4 and 9.3% respectively, black
bars, FIG. 13F). All remaining samples contained approximately 4% CD8+ T
cells that could proliferate in response to adenovirus except for animal
40347 (2.2%).
[0181] The Antibody-Mediated Response
[0182] Anti-Ebola GP and anti-adenovirus antibody levels were assessed in
serum and BAL fluid 20 and 38 days after immunization (FIGS. 14A-14C).
Marked levels of anti-Ebola GP IgG antibodies were found in serum from
animals immunized by the IM and the IN/IT routes 20 days after treatment
(FIG. 14A). These levels increased further 38 days after vaccination.
Anti-Ebola GP antibodies were found in the serum of only one of the
animals immunized by the SL route (52165). This animal also had Ebola
GP-specific IgG antibodies in BAL fluid 20 days after treatment (FIG.
14B) that were similar to those found in samples from animals immunized
by the respiratory route. BAL from animals immunized by the IM route did
not contain any detectable levels of anti-Ebola GP antibodies. One sample
from a primate immunized by the IM route (40347) contained a significant
amount of circulating anti-adenovirus neutralizing antibodies (NABs,
1,007 reciprocal dilution, FIG. 14C). The sample from the remaining
animal in the IM group and 2 others from the IN/IT group contained
anti-adenovirus NAB titers of .about.200 reciprocal dilution. Serum from
animals immunized by the SL route did not contain measurable levels of
anti-adenovirus 5 NABs.
[0183] Lethal Challenge with Ebola Virus
[0184] 62 days after immunization, NHPs were challenged with 1,000 pfu of
Ebola virus (1995, Kikwit). One primate immunized by IM injection (40347)
and one animal immunized by the SL route (62125) succumbed to infection 6
days after challenge (FIG. 15A). At this time animal 62125 had a clinical
score of 23, and substantial petechiae were noted upon necropsy. Primate
40347 had a temperature of 40.3.degree. C. and a clinical score of 25 and
experienced notable bleeding. One primate immunized by the IN/IT route
(52483) and one primate immunized by the SL route (62361) died the
following day. Each of these animals had clinical scores above 25 and
significantly decreased food intake the previous day. The remaining
primate immunized by the SL route (52165) expired 8 days after challenge.
One of the primates vaccinated by IM injection (22473) and two of the
animals immunized by the IN/IT route (50459, 52945) survived challenge
(50 and 67% survival IM and IN/IT respectively, FIG. 15A). Moderate drops
in body weight were noted during infection (FIG. 15B). A slight increase
in weight of one animal immunized by the IN/IT route (50459) was noted
during the study period. Changes in body temperature (FIG. 15C) and
clinical scores (FIG. 15D) for each primate were in line with survival
results. The most striking changes in hematology and blood chemistry
values were observed around day 5 postchallenge in the animals that did
not survive. These include significantly elevated liver enzymes with ALT
(FIG. 15E) and ALP (FIG. 15F) values rising to levels 27 and 16 times
baseline respectively and blood urea nitrogen levels rising to 7.5 times
normal values before the animals expired (FIG. 15G). Platelet counts,
however, dropped to half the baseline values in these animals (FIG. 15H).
In contrast, a sharp increase in platelets was noted in samples obtained
from animals that survived challenge. Other hematology and blood
chemistry values in these animals remained largely unchanged (data not
shown).
TABLE-US-00003
TABLE 3
Primate Study 2: Shedding Patterns of Adenovirus DNA from the Rectal
Mucosa
of Non-Human Primates after a Single Dose of AdCAGoptZGP.sup.a
route of immunization animal # pre 0.25 d 1 d 2 d 7 d 20 d
IN/IT 0810003 --.sup.b .sup. 1,500.sup.c 1.0 .times. 10.sup.5 3.7 .times.
10.sup.4 2,000 2,100
0802197 -- 380 7.5 .times. 10.sup.5 2.6 .times. 10.sup.5 420 540
0809077 -- -- 3.1 .times. 10.sup.4 9.0 .times. 10.sup.4 620 2,600
SL 0805257 -- 83 6.0 .times. 10.sup.6 3.6 .times. 10.sup.5 780 79
0804317 -- 1,400 3.5 .times. 10.sup.4 1.5 .times. 10.sup.4 640 58
0808233 -- 200 5,600 1,600 5,600 24
PEI-SL 0807243 -- 1,100 1.2 .times. 10.sup.5 1,100 190 58
0809227 -- 920 440 1.1 .times. 10.sup.4 130 --
0804819 -- 2,000 1.4 .times. 10.sup.6 1,900 30 --
.sup.aData were obtained by real-time TaqMan PCR on DNA isolated from
samples as described.
.sup.bNone detected. Sample fell below the detection limit of the assay
(10 viral genomes/100 ng of DNA).
.sup.cUnits are genome copies per swab.
Example 11
Results of Primate Study 2
[0185] The second study, referred to as Primate Study 2, evaluated a novel
formulation for the respiratory platform and involved refinement of the
sublingual platform in naive animals and those with prior exposure to
adenovirus. The workflow and treatment schedules for the study are
depicted in FIGS. 10 and 16A-16B.
[0186] Effect of Formulation on Establishing Long-Lasting Immunity to
Ebola and Refinement of Dose for Sublingual Immunization
[0187] The most exciting finding extracted from Study 1 was that the
combined IN/IT administration of the vaccine was able to confer long-term
immunity to Ebola. Since it was not known if immunity induced by
adenovirus-based vaccines for Ebola is persistent over time (Vasconcelos
et al., 2012; Majhen et al., 2014), it was decided to extend the length
of time between respiratory administration of a formulated version of the
vaccine and challenge. A secondary goal was to increase the dose of
vaccine given by the sublingual route and to evaluate the ability of the
sublingual vaccine to confer protection in animals with prior exposure to
adenovirus since improved responses in this population were observed in
studies with rodents (Choi et al., 2013). The long-term immune response
of surviving animals postchallenge was also a major point of interest in
this study especially in animals receiving vaccine containing a novel
formulation (Choi et al., 2014) and in those given the sublingual vaccine
to identify parameters to target during additional refinement of each
immunization platform.
[0188] Three male cynomolgus macaques were given the vaccine in a
potassium phosphate buffer (pH 7.4) containing an amphiphilic polymer
(formula weight (FW) .about.39,000) formulation that improved the
antigen-specific immune response in rodent models of infection (Choi et
al., 2014). The goal was to immunize this group as early in the study as
possible so that there would be a significant amount of time between
immunization and challenge (FIGS. 16A-16B). 42 days after these animals
were immunized, 3 macaques were given 1.times.1011 particles of a host
range mutant adenovirus serotype 5 that can replicate in non-human
primates (Buge et al., 1997; Klessing et al., 1979) by intramuscular
injection to establish pre-existing immunity. 42 days later, animals were
then given the vaccine by the sublingual route. At this time the animals
had an average circulating anti-adenovirus antibody titer of 320.+-.160
reciprocal dilution. Three naive animals were also given the same dose of
vaccine by the sublingual route at the same time for comparison.
[0189] Toxicology and Vaccine Shedding
[0190] In contrast to the first study, a notable spike in creatine
phosphokinase (CPK) was detected in the serum of all animals 24 h after
immunization (FIG. 17A). This enzyme increased to 8 times baseline in one
animal immunized by the IN/IT route (810003, 8,209 IU/L) and to 10 times
baseline in a primate with pre-existing immunity to adenovirus immunized
by the sublingual route (804819, 4,483). A notable spike in serum lactate
dehydrogenase (LDH) was also noted at the 24 h time point. This was not
as sharp as that seen with CPK with the highest elevations found to be
approximately 3 times baseline (804317, 849 IU/L, FIG. 17B). Both
parameters returned to normal within 3 days after treatment. As seen in
the first study, serum AST increased in all primates after immunization.
This occurred at the 24 h time point for animals immunized by the
respiratory and sublingual routes but was not observed in primates with
pre-existing immunity to adenovirus until 48 h (FIG. 17C). As in the
first study, serum alkaline phosphatase (ALP) levels varied between
primates, however, in this trial a distinct drop in this parameter was
noted in samples collected from most animals between the 6 and 24 h time
points, after which values remained constant (FIG. 17D). Other
serological parameters evaluated during the first week after immunization
(calcium, creatinine, albumin, globulin, total protein, gamma glutamyl
transferase (GGT), total bilirubin, alanine aminotransferase (ALT), BUN,
glucose, sodium, potassium, phosphate, chloride, and cholesterol) all
fell within normal limits throughout the course of the study (data not
shown).
[0191] Adenovirus genomes were only found in serum samples collected from
animals immunized by the respiratory route (FIG. 18A). The most
significant numbers of virus genomes detected in any of the biological
samples collected throughout the second study were found in nasal swabs
collected from primates 6 h after IN/IT immunization [810003
(8.18.times.106 genome copies (GC)), 809077 (1.44.times.107 GC), and
802197 (1.36.times.107 GC, FIG. 18B)] and in oral swabs collected from
primates 6 h after sublingual immunization: [804317 (9.06.times.106 GC),
805257 (1.74.times.105 GC), and 808233 (7.92.times.10.sup.6 GC, FIG.
18D)]. As seen in the first study, adenovirus genomes were only found in
the BAL fluid of animals immunized by the IN/IT route (FIG. 18C). Urine
collected from one naive animal immunized by the SL route and another
with pre-existing immunity also immunized by the SL route 6 h after
treatment contained notable amounts of adenovirus (808233, 9,821 GC;
807243, 2,363 GC, FIG. 18E). Adenovirus genomes were found in feces
collected from one primate with pre-existing immunity to adenovirus 24 h
after immunization by the SL route (804819, 2.71.times.106 GC) and in
another primate 2 days after it was immunized by the IN/IT route (802197,
6.51.times.106 GC, FIG. 18F). Virus continued to be shed in feces of this
animal 1 week after immunization (802197, 2.52.times.106 GC). Adenovirus
DNA was found on rectal swabs collected from each animal throughout the
course of the study (Table 3).
[0192] The Long-Term T Cell Response
[0193] The Ebola virus glycoprotein-specific T cell response was examined
in PBMCs isolated from whole blood immediately prior to challenge, 150
days postimmunization. Multiparameter flow cytometry provided a
comprehensive analysis of the types of antigen-specific T cells elicited
by each treatment (FIGS. 19A-19D). The CD4.sup.+ T cell population
present in animals immunized by the IN/IT route was much more diverse
than the CD8.sup.+ T cell population (FIGS. 19A and 19B). Six specific
CD4.sup.+ T cell subpopulations were found in animal 802197 with the most
predominate phenotype being CD4.sup.+ CD107a.sup.+ IL-2.sup.+ (39% of the
CD4 population, FIG. 19A). This animal also had the most diverse
antigen-specific CD8.sup.+ T cell population with 4 different
subpopulations detected by intracellular staining (FIG. 19B). Samples
from NHP 809077 contained four different CD4.sup.+ subpopulations. Cells
that were CD4; IL-2.sup.+ were most prevalent (45%) in this primate. The
CD8.sup.+ population in this animal was composed of 3 specific subtypes
with relatively equal distribution (CD8.sup.+ CD107a.sup.+ IL-2.sup.+,
CD8.sup.+ IFN-.gamma..sup.+, and CD8.sup.+ IL-2.sup.+). The CD4.sup.+ T
cell population was less diverse in primate 810003 with the majority of
antigen-specific cells also having the CD4.sup.+ IL-2.sup.+ phenotype
(85%). The CD8.sup.+ IL-2.sup.+ subpopulation was the most prominent of
two types of antigen-specific CD8.sup.+ T cells found in this primate.
[0194] CD4.sup.+ and CD8.sup.+ T cell populations were noticeably less
diverse in animals immunized by the SL route (FIG. 19C). Antigen-specific
CD4.sup.+ T cells were not detected in samples collected from primate
808233. CD4.sup.+ IFN-.gamma..sup.+ IL-2.sup.+ cells were present to a
lesser degree than CD4.sup.+ IFN-.gamma..sup.+ cells in samples collected
from animal 805257 (25% and 75% of the population respectively). The most
diverse CD4 population elicited by SL immunization was found in primate
804317 with CD4.sup.+ IL-2.sup.+ cells being the most prominent of 5
different subtypes identified in this population. Antigen-specific
CD8.sup.+ T cells were only found in samples collected from this animal
with the majority being of the CD8.sup.+ CD107a.sup.+ phenotype (92.6%)
and the remaining cells of the CD8.sup.+ IL-2.sup.+ phenotype (7.4%, data
not shown).
[0195] Pre-existing immunity to adenovirus did not noticeably alter the
diversity of T cells elicited by sublingual immunization (FIG. 19D). Five
distinct subpopulations of CD4.sup.+ T cells were found in primate 809227
with those of the CD4.sup.+ IL-2.sup.+ being the most prominent (63.1%).
A single population of CD8.sup.+ CD107a.sup.+ cells was also found in
samples collected from this animal (data not shown). CD4.sup.+ IL-4.sup.+
cells were the most prominent of the two antigen-specific CD4.sup.+ T
cell populations found in samples collected from primate 807243.
Antigen-specific CD8.sup.+ T cells were not detected in samples collected
from this animal. SL immunization induced a single population of
CD4.sup.+ IL-2.sup.+ cells and a single population of CD8.sup.+
CD107a.sup.+ cells in primate 804819.
[0196] The Antibody-Mediated Response
[0197] Anti-Ebola GP and anti-adenovirus antibody levels were assessed in
serum and BAL fluid at various time points after immunization (FIGS.
20A-20F). Antigen-specific antibody levels mildly increased between day
20 and day 104 in serum collected from two animals immunized by the IN/IT
route (0810003, 1.5-fold increase, 0809077, 1.3-fold increase, 0802197,
no change, FIG. 20A). Antibody levels remained high at the 142 day time
point and were comparable to those found in animals immunized by the
respiratory route in the first primate study. Significant anti-Ebola GP
antibody levels were detected in the BAL fluid of only one primate
immunized by the IN/IT route (0802197, FIG. 20B). Samples obtained from
one of the animals immunized by the sublingual route (0808233) contained
the highest level of anti-Ebola GP antibodies than any of the other
animals given a single dose of vaccine (FIG. 20C). It is also important
to note that a significant change in anti-Ebola GP antibody levels
between day 20 and day 57 postimmunization was detected in samples
obtained from only one animal in this treatment group (0805257, 2.4-fold
increase). Samples from only one of the animals with prior exposure to
adenovirus immunized by the sublingual route contained anti-Ebola GP
antibodies above the detection limit of the assay (809227, FIG. 20D).
While a notable amount of anti-adenovirus neutralizing antibody (NAB) was
detected in the serum of one primate 20 days after immunization by the
IN/IT route (802197, 1:640 reciprocal dilution), circulating
anti-adenovirus NABs were low in samples obtained from other primates
immunized in the same manner (FIG. 20E). Anti-adenovirus NABs were not
found in the BAL of any of the primates immunized by the IN/IT route
during the course of the study (data not shown). While anti-adenovirus
NABs were quite high in the serum of one animal with pre-existing
immunity 20 days after immunization by the SL route (809227, 1:2,560
reciprocal dilution), they were not detected in samples collected from
two naive primates immunized in the same manner (805257, 804317, FIG.
20F).
[0198] Lethal Challenge with Ebola Virus
[0199] 150 days after immunization, animals were challenged with 1,000 pfu
of Ebola virus (1995, Kikwit). Six days after challenge, both primates
given saline, two animals immunized by the SL route (804317, 808233), and
one animal with pre-existing immunity to adenovirus immunized by the SL
route (809227) expired from infection (FIG. 21A). The remaining primates
with pre-existing immunity succumbed to infection on days 7 (804819) and
8 (807243) respectively. The remaining animal given the vaccine by the SL
route (805257) expired on day 9. Each animal immunized by the respiratory
route survived challenge. These animals experienced minimal changes in
body weight (FIG. 21B) and temperature (FIG. 21C) during the course of
infection with their clinical scores peaking at about 4-7 days after
challenge (FIG. 21D).
[0200] A notable drop in lymphocyte levels of all animals was observed 3
days after challenge (FIG. 21E). Lymphocytes abruptly spiked in one
animal immunized by the SL route (808233) and another with pre-existing
immunity to adenovirus (804819) 6 days after challenge. Lymphocyte levels
of primates immunized by the IN/IT route slowly increased to day 14 where
they remained constant. Lymphocytes of all other animals remained low
until the time of death. ELISpot analysis revealed that a significant
amount of MNCs capable of producing IFN-.gamma. in response to
stimulation with Ebola GP peptides were present in PBMCs isolated from
whole blood of surviving animals 14 days after challenge (FIG. 21F). A
sharp drop in platelet counts was noted in all animals that did not
survive challenge (FIG. 21G). Mild drops in platelet counts were observed
in animals immunized by the IN/IT route 3 days after challenge. These
values continued to drop through day 28. ALT (FIG. 21H) and BUN (FIG.
21I) sharply rose to values as high as 24 and 6 times baseline
respectively in animals that succumbed to Ebola infection. These values
remained unchanged throughout Ebola infection in surviving animals.
[0201] Assessment of sera taken during challenge revealed that primates
immunized by the IN/IT route had very high levels of circulating
anti-Ebola GP antibodies (FIG. 22A). These were neutralizing since very
low levels of infectious Ebola were found in samples taken from two
primates 3 days postchallenge (FIG. 22B). Infectious Ebola virus was not
detected in any samples collected from the third animal in this treatment
group (809077). Ebola virus genomes were also not detected in samples
taken from any of the animals immunized by the respiratory route (Table
4). Although samples from two animals immunized by the sublingual route
also contained high levels of anti-Ebola neutralizing antibody (804317,
808233, 1,280 reciprocal dilution, FIG. 22C), they were only partially
neutralizing since a concentration of 316 TCID.sub.50/mL was found in
samples collected from both primates at the 3 day time point that
escalated to 1.47.times.10.sup.8 and 6.81.times.10.sup.8 TCID50/mL
respectively by the 6 day time point (FIG. 22D). The number of
circulating virus genomes in these animals followed a similar trend
(Table 4). One animal that was exposed to the adenovirus serotype 5 host
range mutant prior to immunization by the SL route (804819) also had high
levels of anti-Ebola GP circulating antibodies (1,280 reciprocal
dilution, FIG. 22E), however, Ebola virus RNA was detected in samples
collected from this animal at a concentration of 8.19.times.10.sup.6
genome copies/mL (Table 4). This animal expired before any infectious
virus could be detected in its serum (FIG. 22F).
TABLE-US-00004
TABLE 4
Primate Study 2: Circulating Ebola Virus Genomes in Primates Challenged
with
Ebola Virus 150 Days after Immunization with a Single Dose of
AdCAGoptZGP.sup.a.
animal no. treatment/route day 0 day 3 day 3.8 day 14 day 21 day 28
0810091 KPBS --.sup.b 880.sup.c 1.84 .times. 10.sup.5 d N.A..sup.e N.A.
0805201 KPBS -- -- 7.79 .times. 10.sup.5 d N.A. N.A.
0802197 IN/IT -- -- N.A. -- -- --
0809077 IN/IT -- -- N.A. -- -- --
0810003 IN/IT -- -- N.A. -- -- --
0805257 SL -- -- N.A. d N.A. N.A.
0804317 SL -- 1.74 .times. 10.sup.4 9.84 .times. 10.sup.6 d N.A. N.A.
0808233 SL -- 1.01 .times. 10.sup.3 1.14 .times. 10.sup.6 d N.A. N.A.
0809227 PEI-SL -- 2.08 .times. 10.sup.4 1.57 .times. 10.sup.4 d N.A. N.A.
0804819 PEI-SL -- -- 8.19 .times. 10.sup.6 d N.A. N.A.
0807243 PEI-SL -- 3.33 .times. 10.sup.4 3.3 .times. 10.sup.5 d N.A. N.A.
.sup.aData were obtained by quantitative RT-PCR on RNA isolated from whole
blood as described.
.sup.bNone detected. Sample fell below the detection limit of the assay
(86 viral genomes/mL).
.sup.cUnits are genome copies per milliliter of whole blood (GC/mL).
.sup.dAnimal expired prior to sample collection at this time point.
.sup.eNot assayed at this time point.
Example 12
Flexible Film Technology
[0202] Biologicals can be stabilized in small, unit dose films useful for
administration to a variety of animal models and for evaluation of
long-term stability of vaccines during long-term storage (see FIG. 23A).
Several thousand doses of a given biological substance can be stabilized
in large films that can be divided into single-use doses (see FIG. 23B).
[0203] A supersaturated solution was created by adding sufficient
stabilizers (sugars and sugar derivatives, polymers) and permeability
enhancers (surfactants) to a solvent system (distilled deionized water,
tris buffer, ethanol, methanol) such that the total amount of solid
components added to the solvent were within the concentration of 10-90%
w/w. In some embodiments, the solution was formulated comprising
potassium phosphate buffered saline (pH 7.4), a detergent (10 mg/ml
PMAL-C16 in certain aspects) and, optionally, one or more sugars.
[0204] This suspension was prepared by stirring, homogenization, mixing
and/or blending these compounds with the solvent. Small portions of each
component (.about. 1/10 the total amount) were added to the solvent and
the solution was mixed before adding additional portions of the same
agent or a new agent.
[0205] Once each stabilizer and permeability enhancer was added, the bulk
solution was placed at 4.degree. C. for a period of time between 2-24
hours. After this time, the bulk solution was subject to sonication for a
period of 5-120 minutes to remove trapped air bubbles in the preparation.
[0206] After sonication was complete, the recombinant adenovirus vector
was added to the preparation. The amount of adenovirus ranged from of
0.1-30% of the total solid concentration. Adjuvants, in some aspects,
were added at this time. The amount of these compounds ranged from
0.005-10% of the total solid concentration. These agents were added by
gentle stirring (10-50 rpm) so as to not induce air pockets and bubble
formation in the final preparation.
[0207] The preparation was then slowly piped into molds of a shape
suitable for the application. In certain aspects, the molds can be
constructed of stainless steel, glass, silicone, polystyrene,
polypropylene and other pharmaceutical grade plastics. In some aspects,
the preparation can be placed in the molds by slowly pouring by hand or
by pushing the preparation through a narrow opening on a collective
container at a slow controlled rate (0.25 ml/min) to prevent early
hardening and/or bubble formation in the final film product. Films were
poured to a thickness of 12.5-1000 .mu.m.
[0208] Molds for casting of films were sterilized by autoclaving and
placed in laminar air flow hoods prior to casting. Molds were also
sometimes lined with a peelable backing material suitable for protection
of the film product. Suitable backings can be made of aluminum, gelatin,
polyesters, polyethylene, polyvinyl and poly lactic co-glycolide polymers
and/or any other pharmaceutically acceptable plastic polymer.
[0209] Cast films remained at ambient temperature (20-25.degree. C.) in a
laminar flow hood for 2-24 hours after which time a thin, peelable film
was formed. Some films were opaque or, preferably, translucent (see FIGS.
23A-23B). Films were then stored at room temperature under controlled
humidity conditions. Some films were stored at 4.degree. C. under
controlled humidity as well.
[0210] Films were porous, amorphous solids that stabilized the recombinant
adenovirus vector in their native three-dimensional shape (see FIGS.
24A-24D). The films retained the shape of the embedded virus after twelve
months of storage at room temperature (FIG. 25).
[0211] Multilayer films can also be created at this time by applying a
second coating of a supersaturated solution containing the same antigen
as the first layer or another different adjuvant/antigen system to the
thin film in a laminar flow hood. This will remain at ambient temperature
(20-25.degree. C.) in a laminar flow hood for an additional 2-24 hours
after which time a thin, peelable film will be formed. This film may be
opaque. It may also be translucent. In certain aspects the films may
likewise comprise multiple film layers.
[0212] Films were dissolved in saline or simulated human saliva warmed to
37.degree. C. (body temperature) and time needed for full dissolution
noted immediately upon drying and at various times during storage. The
resulting solutions were screened for antigen confirmation and activity
to determine the effectiveness of the formulation to retain the potency
of the preparation over time. The results are shown in FIGS. 26-40.
[0213] Both infectious enveloped and non-enveloped viruses were found to
be recoverable from dried film (FIG. 26). Infectious titers of
recombinant adenovirus expressing the Ebola Virus glycoprotein (a
non-enveloped virus) and PR8 (H1N1 influenza) were added to liquid
formulations, dried and reconstituted 48 hours after storage in the dry
state at 20.degree. C. Percent recovery was between 85% and 95% for both
viruses (FIG. 26).
[0214] Different solvent systems influenced changes in film pH during the
drying process (FIG. 27). Solvents such as distilled, deionized water
(1), PBS (phosphate buffered saline (2)), and Tris
(Tris(hydroxymethyl)aminomethane (3)) were used (see FIG. 27). The
solvent system also dictated recovery of virus from dried film (FIGS.
28A-28C). The pH of the dried film significantly impacted recovery of
infectious virus after reconstitution (FIG. 29). The lower the pH, the
lower the percent recovery, when the pH was higher, percent recovery was
higher (FIG. 29). The addition of detergent to the formulation was found
to prevent a drop in film pH after drying (FIG. 30).
[0215] Base formulations also played a role in recovery of virus from
dried film. Three different stabilizer concentrations were evaluated for
their ability to retain infectious titer of virus after drying in two
different solvent systems with varying results (FIGS. 31A-31B). In
addition to affecting pH levels, detergent was found to significantly
improve recovery of infectious virus from the films (FIG. 32). However,
the amount of virus embedded in film formulation did not impact recovery
(FIG. 33). The use of binding agents improved recovery of recombinant
virus film (FIG. 34).
[0216] When compared to blank controls, the virus presence was found to
significantly impact dissolution rate of films in simulated human saliva
(FIG. 35). The addition of a detergent to the film then significantly
improved dissolution time (FIG. 36). Film formulations with and without
detergent were shown to protect adenovirus from degradation in saliva
(FIG. 37).
[0217] The presence of virus in the film significantly increased the
moisture retention in dried film formulations when compared to blank
controls (FIG. 38). The addition of detergent profoundly increased
moisture content in dried film containing virus (FIG. 39). Additionally,
it was found that recombinant adenovirus can be evenly distributed across
large films that can then be divided into equal unit doses (FIG. 40).
[0218] Examples of formulations used in these experiments are shown below
in Table 5.
TABLE-US-00005
TABLE 5
1 .5
2 .5/2S
3 .5/2G
4 1.5
5 1.5/2S.sup.
6 1.5/2G
7 3
8 .sup. 3/2S
9 .sup. 3/2G
0.5 = 0.5% (w/w) HPMC, 1.5 = 1.5% (w/w) HPMC, 3 = 3% (w/w) HPMC, 2S = 2%
(w/w) Sorbitol, 2G = 2% (v/v) Glycerol.
All formulations contained 0.2% w/v tragacanth gum.
[0219] The stability of viral particles in a formulation of the
embodiments is shown in FIGS. 41A-41B. As can be seen in FIG. 41B, even
when in a liquid form, the adenovirus retained nearly all its starting
infectivity after 8 months of storage. Importantly, when stored in a
solid formulation detailed herein nearly all infectivity can be
maintained for longer than 36 months (see FIG. 41A).
[0220] Therefore, the present invention is well adapted to attain the ends
and advantages mentioned as well as those that are inherent therein. The
particular embodiments disclosed above are illustrative only, as the
present invention may be modified and practiced in different but
equivalent manners apparent to those skilled in the art having the
benefit of the teachings herein. Furthermore, no limitations are intended
to the details of construction or design herein shown, other than as
described in the claims below. It is therefore evident that the
particular illustrative embodiments disclosed above may be altered or
modified and all such variations are considered within the scope and
spirit of the present invention. While compositions and methods are
described in terms of "comprising," "containing," or "including" various
components or steps, the compositions and methods can also "consist
essentially of" or "consist of" the various components and steps. All
numbers and ranges disclosed above may vary by some amount. Whenever a
numerical range with a lower limit and an upper limit is disclosed, any
number and any included range falling within the range is specifically
disclosed. In particular, every range of values (of the form, "from about
a to about b," or, equivalently, "from approximately a to b," or,
equivalently, "from approximately a-b") disclosed herein is to be
understood to set forth every number and range encompassed within the
broader range of values. Also, the terms in the claims have their plain,
ordinary meaning unless otherwise explicitly and clearly defined by the
patentee. Moreover, the indefinite articles "a" or "an," as used in the
claims, are defined herein to mean one or more than one of the element
that it introduces. If there is any conflict in the usages of a word or
term in this specification and one or more patent or other documents that
may be incorporated herein by reference, the definitions that are
consistent with this specification should be adopted.
REFERENCES
[0221] Abbink, P., Lemckert, A. A., Ewald, B. A., Lynch, D. M.,
Denholtz, M., Smits, S., Holterman, L., Damen, I., Vogels, R., Thorner,
A. R., O'Brien, K. L., Orville, A., Mansfield, K. G., Goudsmit, J.,
Havenga, M. J., and Barouch, D. H. (2007). Comparative seroprevalence and
immunogenicity of six rare serotype recombinant adenovirus vaccine
vectors from subgroups B and D. J. Virol. 81(9): 4654-4663. [0222] Ahmed,
N.; Gottschalk, S. How to Design Effective Vaccines: Lessons from an Old
Success Story Expert Rev. Vaccines. 2009, 8 (5) 543-546 [0223] AVMA
Guidelines on Euthanasia (Formerly Report of the AVMA Panel on
Euthanasia) June 2007. Available from: avma.org/resources/euthanasia.pdf
[0224] Bachmann, M. F., Jennings, G. T., Vaccine Delivery: A Matter of
Size, Geometry, Kinetics and Molecular Patterns. Nat. Rev. Immunol., 2010
10(11): 787-796. [0225] Bae, K., Choi, J., Jang, Y., Ahn, S., and Hur, B.
(2009). Innovative vaccine production technologies: the evolution and
value of vaccine production technologies. Arch. Pharm. Res. 32(4):
465-480. [0226] Barouch, D. H., Kik, S. V., Weverling, G. J., Dilan, R.,
King, S. L., Maxfield, L. F., Clark, S., Nganga, D., Brandariz, K. L.,
Abbink, P., Sinangil, F., De Bruyn, G., Gray, G. E., Roux, S., Bekker, L.
G., Dilraj, A., Kibuuka, H., Robb, M. L., Michael, N. L., Anzala, O.,
Amornkul, P. N., Gilmour, J., Hural, J., Buchbinder, S. P., Seaman, M.
S., Dolin, R., Baden, L. R., Carville, A., Mansfield, K. G., Pau, M. G.,
and Goudsmit, J., International Seroepidemiology of Adenovirus Serotypes
5, 26, 35, and 48 in Pediatric and Adult Populations. Vaccine, 2011
29(32): 5203-5209. [0227] Beilin, B., Martin, F. C., Shavit, Y., Gale, R.
P., and Liebeskind, J. C. (1989). Suppression of natural killer cell
activity by high-dose narcotic anesthesia in rats. Brain Behav Immun. 3,
129-137. [0228] Bolhassani, A., Javanzad, S., Saleh, T., Hashemi, M.,
Aghasadeghi, M. R., and Sadat, S. M., Polymeric Nanoparticles: Potent
Vectors for Vaccine Delivery Targeting Cancer and Infectious Diseases.
Hum. Vaccin. Immunother., 2014 10(2): 321-332. [0229] Bolton, D. L., and
Roederer, M. (2009). Flow cytometry and the future of vaccine
development. Expert Rev. Vaccines. 8(6): 779-789. [0230] Bolton, S.
(1997). Pharmaceutical Statistics Practical and Clinical Applications.
New York, N.Y., Marcel Dekker, Inc. [0231] Bray, M., Davis, K., Geisbert,
T., Schmaljohn, C., and Huggins, J. (1998). A mouse model for evaluation
of prophylaxis and therapy of Ebola hemorrhagic fever. J Infect Dis. 178,
651-661. [0232] Bray, M., Davis, K., Geisbert, T., Schmaljohn, C., and
Huggins, J., A Mouse Model for Evaluation of Prophylaxis and Therapy of
Ebola Hemorrhagic Fever. J. Infect. Dis., 1999 179(Suppl. 1): S248-S258.
[0233] Bray, M., Hatfill, S., Hensley, L., and Huggins, J. W. (2001).
Haematological, biochemical and coagulation changes in mice, guinea-pigs
and monkeys infected with a mouse-adapted variant of Ebola Zaire virus.
J. Comp. Pathol. 125, 243-253. [0234] Brito, L. A. and O'Hagan, D. T.,
Designing and Building the Next Generation of Improved Vaccine Adjuvants.
J. Control. Release, 2014 190(C): 563-579. [0235] Buge, S. L.;
Richardson, E.; Alipanah, S.; Markham, P.; Cheng, S.; Kalyan, N.; Miller,
C. J.; Lubeck, M.; Udem, S.; Eldridge, J.; Robert-Guroff, M. An
Adenovirus-Simian Immunodeficiency Virus Env Vaccine Elicits Humoral,
Cellular, and Mucosal Immune Responses in Rhesus Macaques and Decreases
Viral Burden Following Vaginal Challenge J. Virol. 1997, 71 (11)
8531-8541 [0236] Bukh, I.; Calcedo, R.; Roy, S.; Carnathan, D. G.; Grant,
R.; Qin, Q.; Boyd, S.; Ratcliffe, S. J.; Veeder, C. L.; Bellamy, S. L.;
Betts, M. R.; Wilson, J. M. Increased Mucosal CD4+ T Cell Activation in
Rhesus Macaques Following Vaccination with an Adenoviral Vector J. Virol.
2014, 88 (15) 8468-8478 [0237] Callahan, S. M., Boquet, M. P., Ming, X.,
Brunner, L. J., and Croyle, M. A., Impact of Transgene Expression on Drug
Metabolism Following Systemic Adenoviral Vector Administration. J. Gene
Med., 2006 8(5): 566-576. [0238] Callahan, S. M., Wonganan, P.,
Obenauer-Kutner, L. J., Sutjipto, S., Dekker, J. D., and Croyle, M. A.,
Controlled Inactivation of Recombinant Viruses with Vitamin B2. J. Virol.
Methods., 2008 148(1-2): 132-145. [0239] Capone, S.; D'alise, A. M.;
Ammendola, V.; Colloca, S.; Cortese, R.; Nicosia, A.; Folgori, A.
Development of Chimpanzee Adenoviruses as Vaccine Vectors: Challenges and
Successes Emerging from Clinical Trials Expert. Rev. Vaccines 2013, 12
(4) 379-393 [0240] Carter, N.J., Curran, M. P., Live Attenuated Influenza
Vaccine (Flumist.RTM.; Fluenz.TM.): A Review of Its Use in the Prevention
of Seasonal Influenza in Children and Adults. Drugs 2011 71(12):
1591-1622. [0241] Cerboni, S., Gentili, M., and Manel, N., Diversity of
Pathogen Sensors in Dendritic Cells. Adv. Immunol., 2013 120: 211-237.
[0242] Chan, M. Ebola Virus Disease in West Africa--No Early End to the
Outbreak N. Engl. J. Med. 2014, 371 (13) 1183-1185 [0243] Chen, D., and
Kristensen, D. (2009). Opportunities and challenges of developing
thermostable vaccines. Expert Rev. Vaccines. 8(5): 547-557. [0244] Choi,
J. H.; Croyle, M. A. Emerging Targets and Novel Approaches to Ebola Virus
Prophylaxis and Treatment BioDrugs 2013, 27 (6) 565-583 [0245] Choi, J.
H.; Schafer, S. C.; Freiberg, A. L.; Croyle, M. A. Bolstering Components
of the Immune Response Compromised by Prior Exposure to Adenovirus:
Guided Formulation Development for a Nasal Ebola Vaccine. Mol.
Pharmaceutics 2014, submitted [0246] Choi, J. H.; Schafer, S. C.; Zhang,
L.; Juelich, T.; Freiberg, A. N.; Croyle, M. A. Modeling Pre-Existing
Immunity to Adenovirus in Rodents: Immunological Requirements for
Successful Development of a Recombinant Adenovirus Serotype 5-Based Ebola
Vaccine Mol. Pharmaceutics 2013, 10 (9) 3342-3355 [0247] Choi, J. H.;
Schafer, S. C.; Zhang, L.; Kobinger, G. P.; Juelich, T.; Freiberg, A. N.;
Croyle, M. A. A Single Sublingual Dose of an Adenovirus-Based Vaccine
Protects against Lethal Ebola Challenge in Mice and Guinea Pigs Mol.
Pharmaceutics 2012, 9 (1) 156-167 [0248] Choi, J. H., Croyle, M. A.,
Development of Intranasal Formulations for a Human Adenovirus Serotype
5-Based Vaccine with Potential to Bypass Pre-Existing Immunity. Mol.
Ther., 2012 20 (Supplement 1): S176. [0249] Choi, J. H., Dekker, J.,
Schafer, S. C., John, J., Whitfill, C. E., Petty, C. S., Haddad, E. E.,
and Croyle, M. A., Optimized Adenovirus-Antibody Complexes Stimulate
Strong Cellular and Humoral Immune Responses against an Encoded Antigen
in Naive Mice and Those with Preexisting Immunity. Clin. Vaccine
Immunol., 2012 19(1): 84-95. [0250] Choi, J. H., Jonsson-Schmunk, K.,
Qiu, X., Shedlock, D. J., Strong, J., Xu, J. X., Michie, K. L., Audet,
J., Fernando, L., Myers, M. J., Weiner, D., Bajrovic, I., Tran, L. Q.,
Wong, G., Bello, A., Kobinger, G. P., Schafer, S. C., and Croyle, M. A.,
A Single Dose Respiratory Recombinant Adenovirus-Based Vaccine Provides
Long-Term Protection for Non-Human Primates from Lethal Ebola Infection.
Mol. Pharm., 2014 Nov. 14: ePub ahead of print DOI: 10.1021/mp500646d.
[0251] Choi, J. H., Schafer, S. C., Zhang, L., Juelich, T., Freiberg, A
N., and Croyle, M. A., Modeling Pre-Existing Immunity to Adenovirus in
Rodents: Immunological Requirements for Successful Development of a
Recombinant Adenovirus Serotype 5-Based Ebola Vaccine. Mol. Pharm., 2013
3(10): 3342-3355. [0252] Choi, J. H., Schafer, S. C., Zhang, L.,
Kobinger, G. P., Juelich, T., Freiberg, A. N., and Croyle, M. A., A
Single Sublingual Dose of an Adenovirus-Based Vaccine Protects against
Lethal Ebola Challenge in Mice and Guinea Pigs. Mol. Pharm., 2012 9(1):
156-167. [0253] Clark, D. V.; Jahrling, P. B.; Lawler, J. V. Clinical
Management of Filovirus-Infected Patients Viruses 2012, 4 (9) 1668-1688
[0254] Coffman, R. L., Sher, A., and Seder, R. A., Vaccine Adjuvants:
Putting Innate Immunity to Work. Immunity, 2010 33(4): 492-503. [0255]
Cohen, J. Infectious Disease. Ebola Vaccines Racing Forward at Record
Pace Science 2014, 345 (6202) 1228-1229 [0256] Colloca, S.; Barnes, E.;
Folgori, A.; Ammendola, V.; Capone, S.; Cirillo, A.; Siani, L.; Naddeo,
M.; Grazioli, F.; Esposito, M. L.; Ambrosio, M.; Sparacino, A.;
Bartiromo, M.; Meola, A.; Smith, K.; Kurioka, A.; O'hara, G. A.; Ewer, K.
J.; Anagnostou, N.; Bliss, C.; Hill, A. V.; Traboni, C.; Klenerman, P.;
Cortese, R.; Nicosia, A. Vaccine Vectors Derived from a Large Collection
of Simian Adenoviruses Induce Potent Cellular Immunity across Multiple
Species Sci. Transl. Med. 2012, 4 (115) 115ra2 [0257] Connolly, B. M.,
Steele, K. E., Davis, K. J., Geisbert, T. W., Kell, W. M., Jaax, N. K.,
and Jahrling, P. B. (1999). Pathogenesis of experimental Ebola virus
infection in guinea pigs. J. Infect. Dis. 1999 February; 179 Suppl
1:S203-17. 179, S203-S207. [0258] Cook, J. D., Lee, J. E., The Secret
Life of Viral Entry Glycoproteins: Moonlighting in Immune Evasion PLoS
Pathog., 2013 9(5): e1003258. [0259] Costantino, H. R., Ilium, L.,
Brandt, G., Johnson, P. H., and Quay, S. C. (2007). Intranasal delivery:
physicochemical and therapeutic aspects. Int. J. Pharm. 337(1-2): 1-24.
[0260] Croyle, M. A., Patel, A., Tran, K. N., Gray, M., Zhang, Y.,
Strong, J. E., Feldmann, H., and Kobinger, G. P. (2008). Nasal delivery
of an adenovirus-based vaccine bypasses pre-existing immunity to the
vaccine carrier and improves the immune response in mice. PLoS One 3(10):
e3548. [0261] Croyle, M. A., Le, H. T., Linse, K. D., Cerullo, V.,
Toietta, G., Beaudet, A., and Pastore, L., PEGylated Helper-Dependent
Adenoviral Vectors: Highly Efficient Vectors with an Enhanced Safety
Profile. Gene Ther., 2005 12(7): 579-587. [0262] Croyle, M. A., Cheng,
X., Sandhu, A., and Wilson, J. M., Development of Novel Formulations That
Enhance Adenoviral-Mediated Gene Expression in the Lung in Vitro and in
Vivo. Mol. Ther., 2001 4.(1): 22-28. [0263] Croyle, M. A., Chirmule, N.,
Zhang, Y., and Wilson, J. M., "Stealth" Adenoviruses Blunt Cell-Mediated
and Humoral Immune Responses against the Virus and Allow for Significant
Gene Expression Upon Readministration in the Lung. J. Virol., 2001
75(10): 4792-4801. [0264] Croyle, M. A., Patel, A., Tran, K. N., Gray,
M., Zhang, Y., Strong, J. E., Feldmann, H., and Kobinger, G. P., Nasal
Delivery of an Adenovirus-Based Vaccine Bypasses Pre-Existing Immunity to
the Vaccine Carrier and Improves the Immune Response in Mice. PLoS One,
2008 3(10): e3548. [0265] Croyle, M. A., Yu, Q. C., and Wilson, J. M.,
Development of a Rapid Method for the PEGylation of Adenoviruses with
Enhanced Transduction and Improved Stability under Harsh Storage
Conditions. Hum. Gene Ther., 2000 11(12): 1713-1722. [0266] Czerkinsky,
C.; Holmgren, J. Mucosal Delivery Routes for Optimal Immunization:
Targeting Immunity to the Right Tissues Curr. Top. Microbiol. Immunol.
2012, 354, 1-18 [0267] Danhier, F., Ansorena, E., Silva, J. M., Coco, R.,
Le Breton, A., and Preat, V., PLGA-Based Nanoparticles: An Overview of
Biomedical Applications. J. Control. Release, 2012 161(2): 505-522.
[0268] De Gregorio, E., Rappuoli, R., From Empiricism to Rational Design:
A Personal Perspective of the Evolution of Vaccine Development. Nat. Rev.
Immunol., 2014 4(7): 505-514. [0269] Dejupesland, P. G., Nasal Drug
Delivery Devices: Characteristics and Performance in a Clinical
Perspective--a Review. Drug Deliv. and Transl. Res., 2013 3(1): 42-62.
[0270] Delany, I., Rappuoli, R., and De Gregorio, E., Vaccines for the
21st Century. EMBO Mol. Med., 2014 6(6): 708-720. [0271] Della Pia, E.
A., Hansen, R. W., Zoonens, M., and Martinez, K. L., Functionalized
Amphipols: A Versatile Toolbox Suitable for Applications of Membrane
Proteins in Synthetic Biology. J. Membr. Biol., 2014 247(9-10): 815-826.
[0272] Desvignes, C., Esteves, F., Etchart, N., Bella, C., Czerkinsky,
C., and Kaiserlian, D. (1998). The murine buccal mucosa is an inductive
site for priming class I-restricted CD8+ effector T cells in vivo. Clin.
Exp. Immunol. 113(3): 386-393. [0273] Dhere, R., Yeolekar, L., Kulkarni,
P., Menon, R., Vaidya, V., Ganguly, M., Tyagi, P., Barde, P., and Jadhav,
S., A Pandemic Influenza Vaccine in India: From Strain to Sale within 12
Months. Vaccine, 2011 29 (Suppl. 1): A16-A21. [0274] Djupesland, P. G.
Nasal Drug Delivery Devices: Characteristics and Performance in a
Clinical Perspective--a Review Drug Delivery Transl. Res. 2013, 3 (1)
42-62 [0275] Ducusin, J., Narvaez, D., Wilburn, S., Mahmoudi, F., Orris,
P., Sobel, H., Bersola, E., and Ricardo, M. (2004). Waste Management and
Disposal During the Philippine Follow-Up Measles Campaign. Washington,
D.C., U.S.A. and Manilla, Philippines, Health Care without Harm and the
Philippine Department of Health: 1-112. [0276] Duerr, A.; Huang, Y.;
Buchbinder, S.; Coombs, R. W.; Sanchez, J.; Del Rio, C.; Casapia, M.;
Santiago, S.; Gilbert, P.; Corey, L.; Robertson, M. N.; STEP/HVTN 504
Study Team. Extended Follow-up Confirms Early Vaccine-Enhanced Risk of
HIV Acquisition and Demonstrates Waning Effect over Time among
Participants in a Randomized Trial of Recombinant Adenovirus HIV Vaccine
(STEP Study) J. Infect. Dis. 2012, 206 (2) 258-266 [0277] Ebola
Haemmorrhagic Fever in Zaire, 1976. Bull. W.H.O. 1978, 56 (2), 271-292.
[0278] Ebola Outbreak in West Africa. 2014; Centers for Disease Control
and Prevention: Atlanta, Ga.,
http://www.cdc.gov/vhf/ebola/outbreaks/guinea/index.html. [0279] Expert
Rev. Vaccines. 8(8): 1083-1097. [0280] Fanning, S. L., Appel, M. Y.,
Berger, S. A., Korngold, R., Friedman, T. M., The Immunological Impact of
Genetic Drift in the B10.Br Congenic Inbred Mouse Strain. J. Immunol.,
2009 183(7): 4261-4272. [0281] Fenimore, P. W., Muhammad, M. A., Fischer,
W. M., Foley, B. T., Bakken, R. R., Thurmond, J. R., Yusim, K., Yoon, H.,
Parker, M., Hart, M. K., Dye, J. M., Korber, B., and Kuiken, C.,
Designing and Testing Broadly-Protective Filoviral Vaccines Optimized for
Cytotoxic T-Lymphocyte Epitope Coverage. PLoS One, 2012 7(10): e44769.
[0282] Fortuna, A., Alves, G., Serralheiro, A., Sousa, J., and Falcao,
A., Intranasal Delivery of Systemic-Acting Drugs: Small-Molecules and
Biomacromolecules. Eur. J. Pharm. Biopharm., 2014 Mar. 28 (ePub ahead of
print). [0283] Fowler, R. A.; Fletcher, T.; Fischer, I.; W. A;
Lamontagne, F.; Jacob. S.; Brett-Major, D.; Lawler, J. V.; Jacquerioz, F.
A.; Houlihan, C.; O'Dempsey, T.; Ferri, M.; Adachi, T.; Lamah, M. C.;
Bah, E. I.; Mayet, T.; Schieffelin, J.; Mclellan, S. L.; Senga, M.; Kato,
Y.; Clement, C.; Mardel, S.; Vallenas Bejar De Villar, R. C.; Shindo, N.;
Bausch, D. Caring for Critically Ill Patients with Ebola Virus Disease:
Perspectives from West Africa Am. J. Respir. Crit. Care Med. 2014, 90 (7)
733-737 [0284] Fraser, K. A., Schenkel, J. M., Jameson, S. C., Vezys, V.,
and Masopust, D., Pre-Existing High Frequencies of Memory CD8+ T Cells
Favor Rapid Memory Differentiation and Preservation of Proliferative
Potential Upon Boosting. Immunity, 2013 39(1): 171-183.
[0285] Ftika, L.; Maltezou, H. C. Viral Haemorrhagic Fevers in Healthcare
Settings J. Hosp. Infect. 2013, 83 (3) 185-192 [0286] Geber, W. F.,
Lefkowitz, S. S., and Hung, C. Y. (1977). Duration of interferon
inhibition following single and multiple injections of morphine. J.
Toxicol. Environ. Health. 2, 577-582. [0287] Geisbert, T. W., Pushko, P.,
Anderson, K., Smith, J., Davis, K. J., and Jahrling, P. B. (2002).
Evaluation in nonhuman primates of vaccines against Ebola virus. Emerg
Infect Dis 8, 503-507. [0288] Geisbert, T. W., Bailey, M., Hensley, L.,
Asiedu, C., Geisbert, J., Stanley, D., Honko, A., Johnson, J., Mulangu,
S., Pau, M. G., Custers, J., Vellinga, J., Hendriks, J., Jahrling, P.,
Roederer, M., Goudsmit, J., Koup, R., and Sullivan, N.J., Recombinant
Adenovirus Serotype 26 (Ad26) and Ad35 Vaccine Vectors Bypass Immunity to
Ad5 and Protect Nonhuman Primates against Ebolavirus Challenge. J.
Virol., 2011 85(9): 4222-4233. [0289] General Chapter <71>
Sterility Tests. In The United States Pharmacopiea (37th Rev.) and the
National Formulary, 32nd ed.; The United States Pharmacopeial Convention:
Rockville, Md., 2014; pp 71-77. [0290] Gerdes, J.; Schwab, U.; Lemke, H.;
Stein, H. Production of a Mouse Monoclonal Antibody Reactive with a Human
Nuclear Antigen Associated with Cell Proliferation Int. J. Cancer 1983,
31 (1) 13-20 [0291] Gilbert, R.; Guilbault, C.; Gagnon, D.; Bernier, A.;
Bourget, L.; Elahi, S. M.; Kamen, A.; Massie, B. Establishment and
Validation of New Complementing Cells for Production of El-Deleted
Adenovirus Vectors in Serum-Free Suspension Culture J. Virol. Methods
2014, 208, 177-178 [0292] Giudice, E. L., and Campbell, J. D. (2006).
Needle-free vaccine delivery. Adv. Drug Deliv. Rev. 58(1): 68-89. [0293]
Gray, G. E.; Moodie, Z.; Metch, B.; Gilbert, P. B.; Bekker, L. G.;
Churchyard, G.; Nchabeleng, M.; Mlisana, K.; Laher, F.; Roux, S.; Mngadi,
K.; Innes, C.; Mathebula, M.; Allen, M.; Mcelrath, M. J.; Robertson, M.;
Kublin, J.; Corey, L.; HVTN 503/Phambili Study Team. Recombinant
Adenovirus Type 5 HIV Gag/Pol/Nef Vaccine in South Africa: Unblinded,
Long-Term Follow-up of the Phase 2b HVTN 503/Phambili Study Lancet
Infect. Dis. 2014, 14 (5) 388-396 [0294] Gregory, A. E., Titball, R., and
Williamson, D., Vaccine Delivery Using Nanoparticles. Front. Cell Infect.
Microbiol., 2013 3: 13. [0295] Hassan, N., Ahad, A., Ali, M., and Ali, J.
(2010). Chemical permeation enhancers for transbuccal drug delivery.
Expert Opin Drug Deliv. 7(1): 97-112. [0296] Hill, M. W. (1984). Cell
Renewal in Oral Epithelia. The Structure and Function of Oral Mucosa. J.
Meyer, Squier, C. A., Gerson, S. J., Eds. New York, Pergamon. [0297]
Hoenen, T., Groseth, A., and Feldmann, H., Current Ebola Vaccines.
Expert. Opin. Biol. Ther., 2012 12(7): 859-872. [0298] Hokey, D. A.;
Johnson, F. B.; Smith, J.; Weber, J. L.; Yan, J.; Hirao, L.; Boyer, J.
D.; Lewis, M. G.; Makedonas, G.; Betts, M. R.; Weiner, D. B. Activation
Drives PD-1 Expression During Vaccine-Specific Proliferation and
Following Lentiviral Infection in Macaques Eur. J. Immunol. 2008, 38 (5)
1435-1445 [0299] Holmgren, J., Svennerholm, A. M., Vaccines against
Mucosal Infections. Curr. Opin. Immunol., 2012 24(3): 343-353. [0300]
Hung, C. Y., Lefkowitz, S. S, and Geber, W. F. (1973). Interferon
inhibition by narcotic analgesics. Proc. Soc. Exp. Biol. Med. 142,
106-111. [0301] Hurwitz, J. L., Respiratory Syncytial Virus Vaccine
Development. Expert Rev. Vaccines, 2011 10(10): 1415-1433. [0302] Hutton,
G., and Tediosi, F. (2006). The costs of introducing a malaria vaccine
through the expanded program on immunization in Tanzania. Am. J. Trop.
Med. Hyg. 75(2 Suppl.): 119-130. [0303] Ibrahim, J., Gerson, S. J., and
Meyer, J. (1985). Frequency and distribution of binucleate cells in oral
epithelium of several species of laboratory rodents. Arch. Oral Biol.
30(8): 627-633. [0304] Ingulli, E. (2007). Tracing tolerance and immunity
in vivo by CFSE-labeling of administered cells. Methods Mol. Biol. 380:
365-376. [0305] Jacobsen, J., Nielsen, E. B., Brondum-Nielsen, K.,
Christensen, M. E., Olin, H. B., Tommerup, N., Rassing, M. R. (1999).
Filter-grown TR146 cells as an in vitro model of human buccal epithelial
permeability. Eur. J. Oral Sci. 107(2): 138-146. [0306] Jacobson, R. M.,
Swan, A., Adegbenro, A., Ludington, S. L., Wollan, P. C., and Poland, G.
A. (2001). Making vaccines more acceptable--methods to prevent and
minimize pain and other common adverse events associated with vaccines.
Vaccine 19(17-19): 2418-2427. [0307] Jain, S., O'Hagan, D. T., and Singh,
M., The Long-Term Potential of Biodegradable Poly(Lactide-Co-Glycolide)
Microparticles as the Next-Generation Vaccine Adjuvant. Expert Rev.
Vaccines., 2011 10(12): 1731-1742. [0308] Johnson, K. M.; Lange, J. V.;
Webb, P. A.; Murphy, F. A. Isolation and Partial Characterisation of a
New Virus Causing Acute Haemorrhagic Fever in Zaire Lancet 1977, 1 (8011)
569-571 [0309] Kane, A., Lloyd, J., Zaffran, M., Simonsen, L., and Kane,
M. (1999). Transmission of hepatitis B, hepatitis C and human
immunodeficiency viruses through unsafe injections in the developing
world: model-based regional estimates. Bull. World Health Organ. 77(10):
801-807. [0310] Klessig, D. F.; Grodzicker, T. Mutations That Allow Human
Ad2 and Ad5 to Express Late Genes in Monkey Cells Map in the Viral Gene
Encoding the 72 k DNA Binding Protein Cell 1979, 17 (4) 957-966 [0311]
Kobinger, G. P., Feldmann, H., Zhi, Y., Schumer, G., Gao, G., Feldmann,
F., Jones, S., and Wilson, J. M. (2006). Chimpanzee adenovirus vaccine
protects against Zaire Ebola virus. Virology 346(2): 394-401. [0312]
Kolate, A., Baradia, D., Patil, S., Vhora, I., Kore, G., and Misra, A.,
PEG--A Versatile Conjugating Ligand for Drugs and Drug Delivery Systems.
J. Control. Release, 2014 192(C): 67-81. [0313] Kraan, H.; Vrieling, H.;
Czerkinsky, C.; Jiskoot, W.; Kersten, G.; Amorij, J. P. Buccal and
Sublingual Vaccine Delivery J. Controlled Release 2014, 190, 580-592
[0314] Kupferschmidt, K. Infectious Disease. Estimating the Ebola
Epidemic Science 2014, 345 (6201) 1108 [0315] Langer, R., Polymeric
Delivery Systems for Controlled Drug Release. Chem. Eng. Communicat.,
1980 6(1-3): 1-48. [0316] Le Bon, C., Popot, J. L., and Giusti, F.,
Labeling and Functionalizing Amphipols for Biological Applications. J.
Mebr. Biol., 2014 247(9-10): 797-814. [0317] Ledgerwood, J. E., Dezure,
A. D., Stanley, D. A., Novik, L., Enama, M. E., Berkowitz, N. M., Hu, Z.,
Joshi, G., Ploquin, A., Sitar, S., Gordon, I. J., Plummer, S. A., Holman,
L. A., Hendel, C. S., Yamshchikov, G., Roman, F., Nicosia, A., Colloca,
S., Cortese, R., Bailer, R. T., Schwartz, R. M., Roederer, M., Mascola,
J. R., Koup, R. A., Sullivan, N.J., Graham, B. S. And the VRC207 Study
Team., Chimpanzee Adenovirus Vector Ebola Vaccine--Preliminary Report. N.
Engl. J. Med., 2014 Nov. 26: ePub ahead of print. [0318] Lee, J. E.,
Fusco, M. L., and Ollman-Saphire, E., An Efficient Platform for Screening
Expression and Crystallization of Glycoproteins Produced in Human Cells.
Nat. Protoc., 2009 4(4): 592-604. [0319] Lerner, S. P., Anderson, C. P.,
Harrison, D. E., Walford, R. L., and Finch, C. E., Polygenic Influences
on the Length of Oestrous Cycles in Inbred Mice Involve MHC Alleles. Eur.
J. Immunogenet., 1992 19(6): 361-371. [0320] Levine, M. M., and
Robins-Browne, R. (2009). Vaccines, global health and social equity.
Immunol. Cell Biol. 87(4): 274-278. [0321] Littman, R. J., The Plauge of
Athens: Epidemiology and Paleopathology. Mt. Siani J. Med., 2009 76(5):
456-467. [0322] MacNeil, A. and Rollin, P. E., Ebola and Marburg
Hemorrhagic Fevers: Neglected Tropical Diseases? PLoS Negl. Trop. Dis.,
2012 6(6): e1546. [0323] Majhen, D.; Calderon, H.; Chandra, N.; Fajardo,
C. A.; Rajan, A.; Alemany, R.; Custers, J. Adenovirus-Based Vaccines for
Fighting Infectious Diseases and Cancer: Progress in the Field Hum. Gene
Ther. 2014, 25 (4) 301-317 [0324] Makedonas, G.; Betts, M. R.
Polyfunctional Analysis of Human T Cell Responses: Importance in Vaccine
Immunogenicity and Natural Infection Springer Semin. Immunopathol. 2006,
28 (3)209-219 [0325] Mao, S., Cun, D., and Kawaashima, Y. (2009). Novel
Non-Injectable Formulation Approaches of Peptides and Proteins. Delivery
Technologies for Biopharmaceuticals Peptides, Proteins, Nucelic Acids and
Vaccines. L. Jorgensen, and Nielsen, H. M., Eds. West Sussex, United
Kingdom, John Wiley & Sons Ltd.: 29-67. [0326] Marie, E., Sagan, S.,
Cribier, S., and Tribet, C., Amphiphilic Macromolecules on Cell
Membranes: From Protective Layers to Controlled Permeabilization. J.
Mebr. Biol., 2014 47(9-10): 861-881. [0327] Marone, G., Stellato, C.,
Mastronardi, P., Mazzarella, B. (1993). Mechanisms of activation of human
mast cells and basophils by general anesthetic drugs. Ann. Fr. Anesth.
Reanim. 12, 116-125. [0328] Marzi, A., Engelmann, F., Feldmann, F.,
Haberthur, K., Shupert, W. L., Brining, D., Scott, D. P., Geisbert, T.
W., Kawaoka, Y., Katze, M. G., Feldmann, H., and Messaoudi, I.,
Antibodies Are Necessary for rVSV/ZEBOV-GP-Mediated Protection against
Lethal Ebola Virus Challenge in Nonhuman Primates. Proc. Natl. Acad. Sci.
U.S.A, 2013 110(5): 1893-1898. [0329] Marzi, A.; Feldmann, H. Ebola Virus
Vaccines: An Overview of Current Approaches Expert Rev. Vaccines 2014, 13
(4) 521-531 [0330] Matthias, D. M., Robertson, J., Garrison, M. M.,
Newland, S., and Nelson, C. (2007). Freezing temperatures in the vaccine
cold chain: a systematic literature review. Vaccine 25(20): 3980-3986.
[0331] Mcallister, S. C., Schleiss, M. R., Prospects and Perspectives for
Development of a Vaccine against Herpes Simplex Virus Infections. Expert
Rev. Vaccines, 2014 13(11): 1349-1360 [0332] Meltzer, M. I.; Atkins, C.
Y.; Santibanez, S.; Knust, B.; Petersen, B. W.; Ervin, E. D.; Nichol, S.
T.; Damon, I. K.; Washington, M. L. Estimating the Future Number of Cases
in the Ebola Epidemic-Liberia and Sierra Leone, 2014-2015 MMWR Surveill.
Summ. 2014, 63 (3) 1-14 [0333] Mutsch, M., Zhou, W., Rhodes, P., Bopp,
M., Chen, R. T., Linder, T., Spyr, C., and Steffen, R. (2004). Use of the
inactivated intranasal influenza vaccine and the risk of Bell's palsy in
Switzerland. N. Engl. J. Med. 350(9): 896-903. [0334] Nakayama, E.,
Saijo, M., Animal Models for Ebola and Marburg Virus Infections. Front.
Microbiol., 2013 4(267). [0335] Nir, Y., Paz, A., Sabo, E., and Potasman,
I. (2003). Fear of injections in young adults: prevalence and
associations. Am. J. Trop. Med. Hyg. 68(3): 341-344. [0336] Nwanegbo, E.,
Vardas, E., Gao, W., Whittle, H., Sun, H., Rowe, D., Robbins, P. D., and
Gambotto, A. (2004). Prevalence of neutralizing antibodies to adenoviral
serotypes 5 and 35 in the adult populations of The Gambia, South Africa,
and the United States. Clin. Diagn. Lab Immunol. 11(2): 351-357. [0337]
Ong, H. X., Traini, D., and Young, P. M., Pharmaceutical Applications of
the Calu-3 Lung Epithelia Cell Line. Expert Opin. Drug Deliv., 2013
10(9): 1287-1302. [0338] Patel, A., Zhang, Y., Croyle, M., Tran, K.,
Gray, M., Strong, J., Feldmann, H., Wilson, J. M., and Kobinger, G. P.,
Mucosal Delivery of Adenovirus-Based Vaccine Protects against Ebola Virus
Infection in Mice. J. Infect. Dis., 2007 96(Suppl. 2): S413-S420. [0339]
Pather, S. I., Rathbone, M. J., and Senel, S. (2008). Current status and
the future of buccal drug delivery systems. Expert Opin. Drug Deliv.
5(5): 531-542. [0340] Pavot, V.; Rochereau, N.; Genin, C.; Verrier, B.;
Paul, S. New Insights in Mucosal Vaccine Development Vaccine 2012, 30 (2)
142-154 [0341] Piersma, F. E., Daemen, M. A., Bogaard, A. E., and
Buurman, W. A. (1999). Interference of pain control employing opioids in
in vivo immunological experiments. Lab Animal 33, 328-333. [0342]
Pratheek, B. M., Saha, S., Maiti, P. K., Chattopadhyay, S., and
Chattopadhyay, S., Immune Regulation and Evasion of Mammalian Host Cell
Immunity During Viral Infection. Indian J. Virol., 2013 24(1): 1-15.
[0343] Pruss-Ustuin, A., Rapiti, E., and Hutin, Y. (2005). Estimation of
the global burden of disease attributable to contaminated sharps injuries
among health-care workers. Am. J. Ind. Med. 48(6): 482-490. [0344] Qiu,
X., Audet, J., Wong, G., Pillet, S., Bello, A., Cabral, T., Strong, J.
E., Plummer, F., Corbett, C. R., Alimonti, J. B., and Kobinger, G. P.,
Successful Treatment of Ebola Virus-Infected Cynomolgus Macaques with
Monoclonal Antibodies. Sci. Transl. Med., 2012 4(138): 138ra81. [0345]
Qiu, X.; Wong, G.; Fernando, L.; Audet, J.; Bello, A.; Strong, J.;
Alimonti, J. B.; Kobinger, G. P. Mabs and Ad-Vectored IFN-.alpha. Therapy
Rescue Ebola-Infected Nonhuman Primates when Administered after the
Detection of Viremia and Symptoms Sci. Transl. Med. 2013, 5 (207)
207ra143 [0346] Qureshi, H.; Genesca, M.; Fritts, L.; Mcchesney, M. B.;
Robert-Guroff, M.; Miller, C. J. Infection with Host-Range Mutant
Adenovirus 5 Suppresses Innate Immunity and Induces Systemic CD4+ T Cell
Activation in Rhesus Macaques PLoS One 2014, 9 (9) e106004 [0347] Rao,
M., Matyas, G. R., Grieder, F., Anderson, K., Jahrling, P. B., and
Alving, C. R., Cytotoxic T Lymphocytes to Ebola Zaire Virus Are Induced
in Mice by Immunization with Liposomes Containing Lipid A. Vaccine 1999
17(23-24): 2991-2998. [0348] Rao, V. R., Upadhyay, A. K., and Kompella,
U. B., pH Shift Assembly of Adenoviral Serotype 5 Capsid Protein
Nanosystems for Enhanced Delivery of Nanoparticles, Proteins and Nucleic
Acids. J. Control. Release, 2013 172(1): 341-350. [0349] Reddick, L. E.,
Alto, N. M., Bacteria Fighting Back: How Pathogens Target and Subvert the
Host Innate Immune System. Mol. Cell, 2014 54(2): 321-328. [0350] Reed,
L. J., Muench, H., A Simple Method of Estimating Fifty Percent Endpoints.
Am. J. Hyg., 1938 27: 493-497. [0351] Renteria, S. S., Clemens, C. C.,
and Croyle, M. A., Development of a Nasal Adenovirus-Based Vaccine:
Effect of Concentration and Formulation on Adenovirus Stability and
Infectious Titer During Actuation from Two Delivery Devices. Vaccine,
2010 28(9): 2137-2148. [0352] Richardson, J. S.; Abou, M. C.; Tran, K.
N.; Kumar, A.; Sahai, B. M.; Kobinger, G. P. Impact of Systemic or
Mucosal Immunity to Adenovirus on Ad-Based Ebola Virus Vaccine Efficacy
in Guinea Pigs J. Infect. Dis. 2011, 204 (Suppl. 3) S1032-S1042 [0353]
Richardson, J. S., Pillet, S., Bello, A. J., and Kobinger, G. P., Airway
Delivery of an Adenovirus-Based Ebola Virus Vaccine Bypasses Existing
Immunity to Homologous Adenovirus in Nonhuman Primates. J. Virol., 2013
87(7): 3668-3677. [0354] Richardson, J. S., Yao, M. K., Tran, K. N.,
Croyle, M. A., Strong, J. E., Feldmann, H., and Kobinger, G. P., Enhanced
Protection against Ebola Virus Mediated by an Improved Adenovirus-Based
Vaccine. PLoS One, 2009 4(4): e5308. [0355] Riese, P., Sakthivel, P.,
Trittel, S., and Guzman, C. A., Intranasal Formulations: Promising
Strategy to Deliver Vaccines. Expert Opin. Drug Deliv., 2014 Jun. 25
(ePub ahead of print): 1-16. [0356] Riese, P., Schulze, K., Ebensen, T.,
Prochnow, B., and Guzman, C. A., Vaccine Adjuvants: Key Tools for
Innovative Vaccine Design. Current Top. Med. Chem., 2013 13(20):
2562-2580.
[0357] Rothe, C.; Schlaich, C.; Thompson, S. Healthcare-Associated
Infections in Sub-Saharan Africa J. Hosp. Infect. 2013, 85 (4) 257-267
[0358] Rupniak, H. T., Rowlatt, C., Lane, E. B., Steele, J. G.,
Trejdosiewicz, L. K., Laskiewicz, B., Povey, S., Hill, B. T. (1985).
Characteristics of four new human cell lines derived from squamous cell
carcinomas of the head and neck. J. Natl. Cancer Inst. 75(4): 621-635.
[0359] Russell, K. L., Hawksworth, A. W., Ryan, M. A., Strickler, J.,
Irvine, M., Hansen, C. J., Gray, G. C., and Gaydos, J. C. (2006).
Vaccine-preventable adenoviral respiratory illness in US military
recruits, 1999-2004. Vaccine24(15): 2835-2842. [0360] Sallusto, F.,
Lanzavecchia, A., Araki, K., and Ahmed, R., From Vaccines to Memory and
Back. Immunity, 2010 33(4): 451-63. [0361] Saphire, E. O., An Update on
the Use of Antibodies against the Filoviruses. Immunotherapy, 2013 5(11):
1221-1233. [0362] Saxena, M., Van, T. T., Baird, F. J., Coloe, P. J., and
Smooker, P. M., Pre-Existing Immunity against Vaccine Vectors--Friend or
Foe?. Microbiology, 2013 159(1): 1-11. [0363] Schafer, B., Holzer, G. W.,
Joachimsthaler, A., Coulibaly, S., Schwendinger, M., Crowe, B. A., Kreil,
T. R., Barrett, P. N., and Falkner, F. G., Pre-Clinical Efficacy and
Safety of Experimental Vaccines Based on Non-Replicating Vaccinia Vectors
against Yellow Fever. PLoS One, 2011 6(9): e24505. [0364] Schieffelin, J.
S.; Shaffer, J. G.; Goba, A.; Gbakie, M.; Gire, S. K.; Colubri, A.;
Sealfon, R. S.; Kanneh, L.; Moigboi, A.; Momoh, M.; Fullah, M.; Moses, L.
M.; Brown, B. L.; Andersen, K. G.; Winnicki, S.; Schaffner, S. F.; Park,
D. J.; Yozwiak, N. L.; Jiang, P. P.; Kargbo, D.; Jalloh, S.; Fonnie, M.;
Sinnah, V.; French, I.; Kovoma, A.; Kamara, F. K.; Tucker, V.; Konuwa,
E.; Sellu, J.; Mustapha, I.; Foday, M.; Yillah, M.; Kanneh, F.; Saffa,
S.; Massally, J. L.; Boisen, M. L.; Branco, L. M.; Vandi, M. A.; Grant,
D. S.; Happi, C.; Gevao, S. M.; Fletcher, T. E.; Fowler, R. A.; Bausch,
D. G.; Sabeti, P. C.; Khan, S. H.; Garry, R. F.; KGH Lassa Fever Program;
Viral Hemorrhagic Fever Consortium; WHO Clinical Response Team. Clinical
Illness and Outcomes in Patients with Ebola in Sierra Leone N. Engl. J.
Med. 2014, [0365] Scott, L. J., Carter, N.J., and Curran, M. P., Live
Attenuated Influenza Vaccine (Fluenz.TM.): A Guide to Its Use in the
Prevention of Seasonal Influenza in Children in the Eu. Paediatr. Drugs,
2012 14(4): 271-279. [0366] Seder, R. A., Darrah, P. A., and Roederer,
M., T-Cell Quality in Memory and Protection: Implications for Vaccine
Design. Nat. Rev. Immunol., 2008 8(4): 247-258. [0367] Shedlock, D. J.;
Talbott, K. T.; Morrow, M. P.; Ferraro, B.; Hokey, D. A.; Muthumani, K.;
Weiner, D. B. Ki-67 Staining for Determination of Rhesus Macaque T Cell
Proliferative Responses Ex Vivo Cytometry A 2010, 77 (3) 275-284 [0368]
Shiferaw, Y.; Abebe, T.; Mihret, A. Sharps Injuries and Exposure to Blood
and Bloodstained Body Fluids Involving Medical Waste Handlers Waste
Manage. Res. 2012, 30 (12) 1299-1305 [0369] Shim, B. S.; Choi, Y.; Cheon,
I. S.; Song, M. K. Sublingual Delivery of Vaccines for the Induction of
Mucosal Immunity Immune Network 2013, 13 (3) 81-85 [0370] Shojaei, A. H.
(1998). Buccal Mucosa as a Route for Systemic Drug Delivery: A Review. J.
Pharm. Pharmaceut. Sci. 1(1): 15-30. [0371] Simonsen, L., Kane, A.,
Lloyd, J., Zaffran, M., and Kane, M. (1999). Unsafe injections in the
developing world and transmission of bloodborne pathogens: a review.
Bull. World Health Organ. 77(10): 789-800. [0372] Soloff, A. C.,
Barratt-Boyes, S. M., Enemy at the Gates: Dendritic Cells and Immunity to
Mucosal Pathogens Cell Res., 2010 20(8): 872-885. [0373] Soma, L. R.
(1983). Anesthetic and analgesic considerations in the experimental
animal. Ann NY Acad Sci 406, 32-47. [0374] Stanley, D. A.; Honko, A. N.;
Asiedu, C.; Trefry, J. C.; Lau-Kilby, A. W.; Johnson, J. C.; Hensley, L.;
Ammendola, V.; Abbate, A.; Grazioli, F.; Foulds, K. E.; Cheng, C.; Wang,
L.; Donaldson, M. M.; Colloca, S.; Folgori, A.; Roederer, M.; Nabel, G.
J.; Mascola, J.; Nicosia, A.; Cortese, R.; Koup, R. A.; Sullivan, N. J.
Chimpanzee Adenovirus Vaccine Generates Acute and Durable Protective
Immunity against Ebolavirus Challenge Nat. Med. 2014, 20(10) 1126-1129
[0375] Stellato, C., Cirillo, R., de Paulis, A., et al. (1992). Human
basophil/mast cell releasability. IX. Heterogeneity of the effects of
opioids on mediator release. Anesthesiology. 77, 932-940. [0376] Stroher,
U., and Feldmann, H. (2006). Progress towards the treatment of Ebola
haemorrhagic fever. Expert Opin Investig Drugs 15, 1523-1535. [0377]
Sullivan, N. J.; Hensley, L.; Asiedu, C.; Geisbert, T. W.; Stanley, D.;
Johnson, J.; Honko, A.; Olinger, G.; Bailey, M.; Geisbert, J. B.;
Reimann, K. A.; Bao, S.; Rao, S.; Roederer, M.; Jahrling, P. B.; Koup, R.
A.; Nabel, G. J. CD8+ Cellular Immunity Mediates Rad5 Vaccine Protection
against Ebola Virus Infection of Nonhuman Primates Nat. Med. 2011,
17(9)1128-1131 [0378] Sullivan, N.J., Geisbert, T. W., Geisbert, J. B.,
Xu, L., Yang, Z. Y., Roederer, M., Koup, R. A., Jahrling, P. B., and
Nabel, G. J., Accelerated Vaccination for Ebola Virus Haemorrhagic Fever
in Non-Human Primates. Nature, 2003 424(6949): 681-684. [0379] Thacker,
E. E., Timares, L., Matthews, Q. L. (2009). Strategies to overcome host
immunity to adenovirus vectors in vaccine development. Expert Rev.
Vaccines. 8(6): 761-777. [0380] Vasconcelos, J. R.; Dominguez, M. R.; Ara
jo, A. F.; Ersching, J.; Tararam, C. A.; Bruna-Romero, O.; Rodrigues, M.
M. Relevance of Long-Lived CD8(+) T Effector Memory Cells for Protective
Immunity Elicited by Heterologous Prime-Boost Vaccination Front. Immunol.
2012, 3, 358 [0381] Weaver, E. A., Barry, M. A., Effects of Shielding
Adenoviral Vectors with Polyethylene Glycol on Vector Specific and
Vaccine Mediated Immune Responses. Hum. Gene Ther., 2008 19(12):
1369-1382. [0382] Wertz, P. W., and Squier, C. A. (1991). Cellular and
molecular basis of barrier function in oral epithelium. Crit. Rev. Ther.
Drug Carrier Syst. 8(3): 237-269. [0383] Wong, G., Kobinger, G., and Qiu,
X., Characterization of Host Immune Responses in Ebola Virus Infections.
Expert Rev. Clin. Immunol., 2014 10(6): 781-790. [0384] Wong, G.,
Richardson, J. S., Pillet, S., Patel, A., Qiu, X., Alimonti, J., Hogan,
J., Zhang, Y., Takada, A., Feldmann, H., and Kobinger, G. P., Immune
Parameters Correlate with Protection against Ebola Virus Infection in
Rodents and Nonhuman Primates. Sci. Transl. Med., 2012 4(158): 158ra146.
[0385] Wong, G.; Audet, J.; Fernando, L.; Fausther-Bovendo, H.; Alimonti,
J. B.; Kobinger, G. P.; Qiu, X. Immunization with Vesicular Stomatitis
Virus Vaccine Expressing the Ebola Glycoprotein Provides Sustained
Long-Term Protection in Rodents Vaccine 2014, 32 (43) 5722-5729 [0386]
Wong, G.; Qiu, X.; Olinger, G. G.; Kobinger, G. P. Post-Exposure Therapy
of Filovirus Infections Trends Microbiol. 2014, 22 (8) 456-463 [0387]
Wonganan, P., Clemens, C C., Brasky, K., Pastore, L., and Croyle, M. A.,
Species Differences in the Pharmacology and Toxicology of PEGylated
Helper-Dependent Adenovirus. Mol. Pharm., 2011 8(1): 78-92. [0388]
Wonganan, P., Croyle, M. A., PEGylated Adenoviruses: From Mice to
Monkeys. Viruses, 2010 2(2):468-502(2): 468-502. [0389] World Health
Organization, (2005). Management of solid health-care waste at primary
health-care centres: a decision-making guide. Department of Immunization,
Vaccines and Biologicals (IVB), Protection of the Human Environment
Water, Sanitation and Health (WSH) Immunization, Protection of the Human
Environment Water, Sanitation and Health (WSH). Geneva, Switzerland,
World Health Organization: 1-53. [0390] World Health Organization,
UNICEF, and World Bank. (2009). State of the World's Vaccines and
Immunization. Geneva, Switzerland, World Health Organization. [0391]
World Health Organization. Ebola Response Roadmap Situation Report 29
Oct. 2014; World Health Organization: Geneva, Switzerland. 2014; pp 1-10.
[0392] Yuki, Y., and Kiyono, H. (2009). Mucosal vaccines: novel advances
in technology and delivery. [0393] Zaman, M., Chandrudu, S., and Toth.
I., Strategies for Intranasal Delivery of Vaccines. Drug Deliv. and
Transl. Res., 2013 3(1): 100-109. [0394] Zhou, W., Pool, V., DeStefano,
F., Iskander, J. K., Haber, P., and Chen, R. T. (2004). A potential
signal of Bell's palsy after parenteral inactivated influenza vaccines:
reports to the Vaccine Adverse Event Reporting System (VAERS)-United
States, 1991-2001. Pharmacoepidemiol. Drug Saf. 13(8): 505-510. [0395]
Zielinski, C. E., Corti, D., Mele, F., Pinto, D., Lanzavecchia, A., and
Sallusto, F., Dissecting the Human Immunologic Memory for Pathogens.
Immunol. Rev., 2011 240(1): 40-51.
Sequence CWU
1
1
818PRTArtificial sequenceSynthetic peptide 1Thr Glu Leu Arg Thr Phe Ser
Ile 1 5 29PRTArtificial sequenceSynthetic
peptide 2Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5
320DNAArtificial sequenceSynthetic primer 3cagccagcaa tttcttccat
20420DNAArtificial
sequenceSynthetic primer 4tttcggttgc tgtttctgtg
20524DNAArtificial sequenceSynthetic primer
5atcattggcg tactggagga gcag
24625DNAArtificial sequenceSynthetic primer 6actatatgga caacgtcaac ccatt
25722DNAArtificial
sequenceSynthetic primer 7accttctgag gcacctggat gt
22821DNAArtificial sequenceSynthetic primer
8accaccgcaa tgctggcctg c 21
* * * * *
![[Image]](/netaicon1/PTO/image.gif)
![[Order Copy]](/netaicon1/PTO/order.gif)
![[PREV_LIST]](/netaicon1/PTO/prevlist.gif)
![[CURR_LIST]](/netaicon1/PTO/hitlist.gif)
![[NEXT_LIST]](/netaicon1/PTO/nextlist.gif)
![[PREV_DOC]](/netaicon1/PTO/prevdoc.gif)
![[NEXT_DOC]](/netaicon1/PTO/nextdoc.gif)
![[Help]](/netaicon1/PTO/help.gif)
![[Home]](/netaicon1/PTO/home.gif)
![[Boolean Search]](/netaicon1/PTO/boolean.gif)
![[Manual]](/netaicon1/PTO/manual.gif)
![[Number Search]](/netaicon1/PTO/number.gif)
![[PTDLs]](/netaicon1/PTO/ptdl.gif)
