| United States Patent Application |
20100048405
|
| Kind Code
|
A1
|
|
Raymer; Paul L.
;   et al.
|
February 25, 2010
|
DEVELOPMENT OF HERBICIDE-RESISTANT GRASS SPECIES
Abstract
The invention relates to a selected and cultured ACCase inhibitor
herbicide-resistant plant-resistant plant from the group Panicodae, or
tissue, seed, or progeny thereof, and methods of selecting the same. The
invention also relates to methods for controlling weeds in the vicinity
of an ACCase inhibitor herbicide-resistant plant.
| Inventors: |
Raymer; Paul L.; (Milner, GA)
; Heckart; Douglas; (Athens, GA)
; Parrott; Wayne Allen; (Athens, GA)
|
| Correspondence Address:
|
DAVIS WRIGHT TREMAINE LLP - San Francisco
505 MONTGOMERY STREET, SUITE 800
SAN FRANCISCO
CA
94111
US
|
| Assignee: |
University of Georgia Research Foundation
Athens
GA
|
| Family ID:
|
41434474
|
| Appl. No.:
|
12/488452
|
| Filed:
|
June 19, 2009 |
Related U.S. Patent Documents
| | | | |
|
| Application Number | Filing Date | Patent Number | |
|---|
| | 61074381 | Jun 20, 2008 | | |
| | 61150459 | Feb 6, 2009 | | |
| | 61172427 | Apr 24, 2009 | | |
|
|
| Current U.S. Class: |
504/343 ; 435/29; 435/410; 536/23.1; 800/263; 800/264; 800/265; 800/267; 800/300 |
| Current CPC Class: |
A01H 5/00 20130101; A01H 1/04 20130101 |
| Class at Publication: |
504/343 ; 800/300; 800/267; 800/265; 800/264; 800/263; 435/29; 435/410; 536/23.1 |
| International Class: |
A01N 35/10 20060101 A01N035/10; A01H 5/00 20060101 A01H005/00; A01H 1/06 20060101 A01H001/06; C12Q 1/02 20060101 C12Q001/02; C12N 5/04 20060101 C12N005/04; C07H 21/00 20060101 C07H021/00; A01P 13/00 20060101 A01P013/00 |
Claims
1. A selected and cultured ACCase inhibitor herbicide-resistant plant
from the group Panicodae, or tissue, seed, or progeny thereof.
2. The ACCase inhibitor herbicide-resistant plant of claim 1, regenerated
from an herbicide-resistant undifferentiated cell that has undergone a
selection method, wherein the selection method comprises: providing a
callus of undifferentiated cells of a plant from the group Panicodae;
contacting the callus with at least one herbicide in an amount sufficient
to retard growth or kill the callus; selecting at least one resistant
cell based upon a differential effect of the herbicide; and regenerating
a viable whole plant of the variety from the at least one resistant cell.
3. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein the
plant is a member of tribe Paniceae.
4. The ACCase inhibitor herbicide-resistant plant of claim 3, wherein the
plant is one selected from the group of: Axonopus (carpetgrass),
Digiteria (crabgrass), Echinochloa, Panicum, Paspalum (Bahiagrass),
Pennisetum, Setaria and Stenotaphrum (St. Augustine grass).
5. The ACCase inhibitor herbicide-resistant plant of claim 3, wherein the
plant is one selected from the group of: seashore paspalum (P.
vaginatum), bent grass, tall fescue grass, Zoysiagrass, bermudagrass
(Cynodon spp), Kentucky Bluegrass, Texas Bluegrass, Perennial ryegrass,
buffalograss (Buchloe dactyloides), centipedegrass (Eremochloa
ophiuroides) and St. Augustine grass (Stenotaphrum secundatum),
Carpetgrass (Axonopus spp.) and Bahiagrass (Paspalum notatum).
6. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein the
plant is resistant to an acetyl coenzyme A carboxylase (ACCase)
inhibitor.
7. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein the
plant is resistant to a cyclohexanedione herbicide, an aryloxyphenoxy
proprionate herbicide, a phenylpyrazoline herbicide, or mixtures thereof.
8. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein the
herbicide resistance is conferred by a mutation at least one amino acid
position of ACCase gene selected from the group of: 1756, 1781, 1999,
2027, 2041, 2078, 2099 and 2096.
9. The ACCase inhibitor herbicide-resistant plant of claim 8, wherein the
herbicide resistance is conferred by an isoleucine to leucine mutation at
amino acid position 1781
10. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein
the plant is resistant to at least one herbicide selected from the group
of: alloxydim, butroxydim, cloproxydim, profoxydim, sethoxydim,
clefoxydim, clethodim, cycloxydim, tepraloxydim, tralkoxydim,
chloraizfop, clodinafop, clofop, cyhalofop, diclofop, fenoxaprop,
fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop, isoxapyrifop,
metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
11. The ACCase inhibitor herbicide-resistant plant of claim 1, wherein
the plant is a non-transgenic plant.
12. A progeny of an ACCase inhibitor herbicide-resistant plant of claim
1.
13. The progeny of claim 12, wherein the progeny is a result of sexual
reproduction of the ACCase inhibitor herbicide-resistant plant parent.
14. The progeny of claim 12, wherein the progeny is a result of asexual
reproduction of the ACCase inhibitor herbicide-resistant plant parent.
15. A seed of an ACCase inhibitor herbicide-resistant plant of claim 1,
or a progeny thereof.
16. A method of identifying a herbicide-resistant plant from the group
Panicodae, comprising: providing a callus of undifferentiated cells of a
plant from the group Panicodae; contacting the callus with at least one
herbicide in an amount sufficient to retard growth or kill the callus;
selecting at least one resistant cell based upon a differential effect of
the herbicide; and regenerating a viable whole plant of the variety from
the at least one resistant cell, wherein the regenerated plant is
resistant to the at least one herbicide.
17. The method of claim 16, further comprising expanding the at least one
resistant cell into a plurality of undifferentiated cells.
18. The method of claim 16, wherein the plant is one selected from the
tribe Paniceae.
19. The method of claim 18, wherein the plant is one selected from the
group of: Axonopus (carpetgrass), Digiteria (crabgrass), Echinochloa,
Panicum, Paspalum (Bahiagrass), Pennisetum, Setaria and Stenotaphrum (St.
Augustine grass).
20. The method of claim 18, wherein the plant is one selected from the
group of: seashore paspalum (P. vaginatum), bentgrass (Agrostis spp),
tall fescue, Zoysiagrass, bermudagrass (Cynodon spp), Kentucky Bluegrass,
Texas Bluegrass, Perennial ryegrass, buffalograss (Buchloe dactyloides),
centipedegrass (Eremochloa ophiuroides) and St. Augustine grass
(Stenotaphrum secundatum), Carpetgrass (Axonopus spp.) and Bahiagrass
(Paspalum notatum).
21. The method of claim 16, wherein the at least one herbicide is an
acetyl coenzyme A carboxylase (ACCase) inhibitor.
22. The method of claim 21, wherein the herbicide resistance is conferred
by a mutation at least one amino acid position of the ACCase gene
selected from the group of: 1756, 1781, 1999, 2027, 2041, 2078, 2099 and
2096.
23. The method of claim 22, wherein the herbicide resistance is conferred
by an isoleucine to leucine mutation at amino acid position 1781.
24. The method of claim 21, wherein the at least one herbicide is
selected from the group of: alloxydim, butroxydim, cloproxydim,
profoxydim, sethoxydim, clefoxydim, clethodim, cycloxydim, tepraloxydim,
tralkoxydim, chloraizfop, clodinafop, clofop, cyhalofop, diclofop,
fenoxaprop, fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop,
isoxapyrifop, metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
25. The method of claim 16, wherein the callus of undifferentiated cells
is provided from a non-transgenic plant.
26. A tissue culture of regenerable cells of an herbicide-resistant plant
identified by the method of claim 16.
27. A method for controlling weeds in the vicinity of a
herbicide-resistant plant identified by the method of claim 16,
comprising: contacting at least one herbicide to the weeds and to the
herbicide-resistant plant, wherein the at least one herbicide is
contacted to the weeds and to the plant at a rate sufficient to inhibit
growth of a non-selected plant of the same species or sufficient to
inhibit growth of the weeds.
28. The method of claim 27, wherein the herbicide-resistant plant is
resistant to an acetyl coenzyme A carboxylase (ACCase) inhibitor.
29. The method of claim 27, wherein the herbicide-resistant plant is a
non-transgenic plant.
30. The method of claim 27, comprising contacting the herbicide directly
to the herbicide-resistant plant.
31. The method of claim 27, comprising contacting the herbicide to a
growth medium in which the herbicide-resistant plant is located.
32. A seashore paspalum-specific DNA marker deposited as ATCC Deposit No.
______, or a fragment thereof, that is capable of identifying
herbicide-resistant grass cultivars.
33. A method of marker-assisted breeding, comprising the steps of:
identifying a feature of interest for breeding and selection, wherein the
feature is in linkage with an ACCase gene; providing a first plant
carrying an ACCase sequence variant capable of conferring upon the plant
resistance to an ACCase-inhibitor herbicide, wherein the plant further
comprises the feature of interest; breeding the first plant with a second
plant; identifying progeny of the breeding step as having the ACCase
sequence variant; and selecting progeny likely to have the feature of
interest based upon the identifying step.
34. The method of claim 33, wherein the feature is selected from: a trait
or, a gene.
35. The method of claim 34, wherein the trait is at least one selected
from the group consisting of: herbicide tolerance, disease resistance,
insect of pest resistance, altered fatty acid, protein or carbohydrate
metabolism, increased growth rates, enhanced stress tolerance, preferred
maturity, enhanced organoleptic properties, altered morphological
characteristics, sterility, other agronomic traits, traits for industrial
uses, or traits for improved consumer appeal.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional Application
Ser. No. 61/074,381, filed on Jun. 20, 2008, U.S. Provisional Application
Ser. No. 61/150,459, filed on Feb. 6, 2009, and U.S. Provisional
Application Ser. No. 61/172,427, filed on Apr. 24, 2009, each of which is
incorporated herein by reference in its entirety.
FIELD
[0002] The invention disclosed herein generally relates to grasses with
resistance to selective grass herbicides and methods to develop the same.
BACKGROUND
[0003] Seashore paspalum (Paspalum vaginatum) is a warm-season turfgrass
that is generally adapted to dune environments. Favorable attributes of
seashore paspalum include its tolerance to salt, water logging, and
drought. These characteristics make paspalum a premium turfgrass
candidate for venues where any or all of these environmental problems
could be an issue. For example, golf course architects recommend seashore
paspalum for new courses in tropical or sub-tropical coastal areas where
salt or water quality can affect turfgrass growth and maintenance. In
addition, many existing golf courses have replaced bermudagrass (Cynodon
dactylon) with paspalum. Compared to bermudagrass, paspalum requires less
nitrogen and is more tolerant of irrigation with brackish or poor quality
water, which reduces management costs and improves irrigation
flexibility.
[0004] A main limitation to replacing bermudagrass with paspalum is
bermudagrass re-establishment. Bermudagrass is highly competitive and
difficult to eradicate once established. Bermudagrass and other weedy
grasses can greatly reduce the aesthetic value and quality of the
paspalum turf. Accordingly, it is desired to control or limit
bermudagrass or weedy grass growth in paspalum-populated areas. To
control the growth of weedy grasses in paspalum-populated turfgrass
areas, the development of paspalum turfgrass with resistance to selective
grass herbicides is desired. Past approaches in development of
herbicide-resistant turfgrass include the use of genetic engineering
approaches. However, plants produced by genetic engineering approaches
may be difficult to commercialize due to governmental regulations and
restrictions regarding the use of genetically modified plants.
Accordingly, embodiments of the invention include the development of
turfgrass cultivars with non-transgenic resistance to herbicides, as well
as cultivars with transgenic resistance.
SUMMARY
[0005] Embodiments of the invention relate to a selected and cultured
ACCase inhibitor herbicide-resistant plant-resistant plant from the group
Panicodae, or tissue, seed, or progeny thereof. In some embodiments, the
ACCase inhibitor herbicide-resistant plant is regenerated from an
herbicide-resistant undifferentiated cell that has undergone a selection
method, wherein the selection method includes: providing a callus of
undifferentiated cells of a plant from the group Panicodae, contacting
the callus with at least one herbicide in an amount sufficient to retard
growth or kill the callus, selecting at least one resistant cell based
upon a differential effect of the herbicide, and regenerating a viable
whole plant of the variety from the at least one resistant cell. In some
embodiments, the plant is a non-transgenic plant.
[0006] In some embodiments of the invention, the ACCase inhibitor
herbicide-resistant plant is a member of tribe Paniceae. In some
embodiments, the ACCase inhibitor herbicide-resistant plant is one
selected from the group of: Axonopus (carpetgrass), Digiteria
(crabgrass), Echinochloa, Panicum, Paspalum (Bahiagrass), Pennisetum,
Setaria and Stenotaphrum (St. Augustine grass). In some embodiments, the
ACCase inhibitor herbicide-resistant plant is one selected from the group
of: seashore paspalum (P. vaginatum), bent grass, tall fescue grass,
Zoysiagrass, bermudagrass (Cynodon spp), Kentucky Bluegrass, Texas
Bluegrass, Perennial ryegrass, buffalograss (Buchloe dactyloides),
centipedegrass (Eremochloa ophiuroides) and St. Augustine grass
(Stenotaphrum secundatum), Carpetgrass (Axonopus spp.) and Bahiagrass
(Paspalum notatum).
[0007] In some embodiments of the invention, the ACCase inhibitor
herbicide-resistant plant is resistant to an acetyl coenzyme A
carboxylase (ACCase) inhibitor. In some embodiments, the ACCase inhibitor
herbicide-resistant plant is resistant to a cyclohexanedione herbicide,
an aryloxyphenoxy proprionate herbicide, a phenylpyrazoline herbicide, or
mixtures thereof. In some embodiments, the ACCase inhibitor
herbicide-resistant plant is resistant to at least one herbicide selected
from the group of: alloxydim, butroxydim, cloproxydim, profoxydim,
sethoxydim, clefoxydim, clethodim, cycloxydim, tepraloxydim, tralkoxydim,
chloraizfop, clodinafop, clofop, cyhalofop, diclofop, fenoxaprop,
fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop, isoxapyrifop,
metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
[0008] In some embodiments of the invention, the herbicide resistance of
the ACCase inhibitor herbicide-resistant plant is conferred by a mutation
at least one amino acid position of ACCase gene selected from the group
of: 1756, 1781, 1999, 2027, 2041, 2078, 2099 and 2096. In some
embodiments, the herbicide resistance is conferred by an isoleucine to
leucine mutation at amino acid position 1781.
[0009] Embodiments of the invention also relate to a progeny of an ACCase
inhibitor herbicide-resistant plant plant as described in any of the
foregoing paragraphs. In some embodiments, the progeny is a result of
sexual reproduction of the ACCase inhibitor herbicide-resistant plant
parent. In some embodiments, the progeny is a result of asexual
reproduction of the ACCase inhibitor herbicide-resistant plant parent.
[0010] Embodiments of the invention are also directed to a seed of an
ACCase inhibitor herbicide-resistant plant as described in any of the
foregoing paragraphs, or a progeny thereof.
[0011] Embodiments of the invention relate to sod comprising an ACCase
inhibitor herbicide-resistant plant of as described in any of the
foregoing paragraphs, or a progeny or seed thereof. Embodiments of the
invention are also directed a turfgrass nursery plot comprising an ACCase
inhibitor herbicide-resistant plant as described in any of the foregoing
paragraphs, or a progeny or seed thereof. In embodiments of the
invention, a commercial lawn, golfcourse, or field comprising an ACCase
inhibitor herbicide-resistant plant as described in any of the foregoing
paragraphs, or a progeny or seed thereof, is provided.
[0012] Embodiments of the invention also relate to a method of identifying
a herbicide-resistant plant from the group Panicodae, including:
providing a callus of undifferentiated cells of a plant from the group
Panicodae, contacting the callus with at least one herbicide in an amount
sufficient to retard growth or kill the callus, selecting at least one
resistant cell based upon a differential effect of the herbicide, and
regenerating a viable whole plant of the variety from the at least one
resistant cell, wherein the regenerated plant is resistant to the at
least one herbicide. In some embodiments, the method further includes
expanding the at least one resistant cell into a plurality of
undifferentiated cells. In some embodiments, the callus of
undifferentiated cells is provided from a non-transgenic plant.
[0013] In some embodiments of the invention, the plant provided in the
method is one selected from the tribe Paniceae. In some embodiments, the
plant is one selected from the group of: Axonopus (carpetgrass),
Digiteria (crabgrass), Echinochloa, Panicum, Paspalum (Bahiagrass),
Pennisetum, Setaria and Stenotaphrum (St. Augustine grass). In some
embodiments, the plant is one selected from the group of: seashore
paspalum (P. vaginatum), bentgrass (Agrostis spp), tall fescue,
Zoysiagrass, bermudagrass (Cynodon spp), Kentucky Bluegrass, Texas
Bluegrass, Perennial ryegrass, buffalograss (Buchloe dactyloides),
centipedegrass (Eremochloa ophiuroides) and St. Augustine grass
(Stenotaphrum secundatum), Carpetgrass (Axonopus spp.) and Bahiagrass
(Paspalum notatum).
[0014] In some embodiments of the invention, the at least one herbicide
used in the method is an acetyl coenzyme A carboxylase (ACCase)
inhibitor. In some embodiments, the at least one herbicide is selected
from the group of: alloxydim, butroxydim, cloproxydim, profoxydim,
sethoxydim, clefoxydim, clethodim, cycloxydim, tepraloxydim, tralkoxydim,
chloraizfop, clodinafop, clofop, cyhalofop, diclofop, fenoxaprop,
fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop, isoxapyrifop,
metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
[0015] In some embodiments of the invention, the herbicide resistance of
the plant is conferred by a mutation at least one amino acid position of
the ACCase gene selected from the group of: 1756, 1781, 1999, 2027, 2041,
2078, 2099 and 2096. In some embodiments, the herbicide resistance is
conferred by an isoleucine to leucine mutation at amino acid position
1781.
[0016] Embodiments of the invention are also directed to a tissue culture
of regenerable cells of an herbicide-resistant plant identified by the
methods as described in the foregoing paragraphs.
[0017] In embodiments of the invention, a method for controlling weeds in
the vicinity of a herbicide-resistant plant is provided, wherein the
herbicide-resistant plant is identified by the methods described in the
foregoing paragraphs, the method including: contacting at least one
herbicide to the weeds and to the herbicide-resistant plant, wherein the
at least one herbicide is contacted to the weeds and to the plant at a
rate sufficient to inhibit growth of a non-selected plant of the same
species or sufficient to inhibit growth of the weeds. In some
embodiments, the herbicide-resistant plant is resistant to an acetyl
coenzyme A carboxylase (ACCase) inhibitor. In some embodiments, the
method includes contacting the herbicide directly to the
herbicide-resistant plant. In some embodiments, the method includes
contacting the herbicide to a growth medium in which the
herbicide-resistant plant is located.
[0018] In some embodiments, the herbicide-resistant plant is resistant to
a cyclohexanedione herbicide, an aryloxyphenoxy proprionate herbicide, a
phenylpyrazoline herbicide, or mixtures thereof. In some embodiments, the
herbicide-resistant plant is a non-transgenic plant.
[0019] In some embodiments of the invention, the herbicide resistance in
the plant is conferred by a mutation at least one amino acid position of
the ACCase gene selected from the group of: 1756, 1781, 1999, 2027, 2041,
2078, 2099 and 2096. In some embodiments, the herbicide resistance is
conferred by an isoleucine to leucine mutation at amino acid position
1781 of the ACCase gene.
[0020] In some embodiments, the at least one herbicide used in the method
is selected from the group of: alloxydim, butroxydim, cloproxydim,
profoxydim, sethoxydim, clefoxydim, clethodim, cycloxydim, tepraloxydim,
tralkoxydim, chloraizfop, clodinafop, clofop, cyhalofop, diclofop,
fenoxaprop, fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop,
isoxapyrifop, metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
[0021] Embodiments of the invention are directed to a seashore
paspalum-specific DNA marker deposited as ATCC Deposit No. ______, or a
fragment thereof, that is capable of identifying herbicide-resistant
grass cultivars. In some embodiments, the seashore-paspalum-specific DNA
marker comprises SEQ ID NO: 5, or a fragment thereof.
[0022] Embodiments of the invention also relate to a method of identifying
a herbicide-resistant plant, including: obtaining a genetic sample of a
plant, and assaying the sample for the presence or absence of a mutation
at position 1781 of the ACCase gene, wherein the presence of a mutation
at position 1781 is indicative of herbicide-resistance in the plant. Also
contemplated are uses of the marker at position 1781 of the ACCase in a
method of identifying an herbicide-resistant plant.
[0023] Embodiments of the invention are drawn to a method of
marker-assisted breeding, including the steps of: identifying a feature
of interest for breeding and selection, wherein the feature is in linkage
with an ACCase gene, providing a first plant carrying an ACCase sequence
variant capable of conferring upon the plant resistance to an
ACCase-inhibitor herbicide, wherein the plant further comprises the
feature of interest, breeding the first plant with a second plant,
identifying progeny of the breeding step as having the ACCase sequence
variant; and selecting progeny likely to have the feature of interest
based upon the identifying step. In some embodiments, the feature is
selected from: a trait or, a gene. In some embodiments, the trait is at
least one selected from the group consisting of: herbicide tolerance,
disease resistance, insect of pest resistance, altered fatty acid,
protein or carbohydrate metabolism, increased growth rates, enhanced
stress tolerance, preferred maturity, enhanced organoleptic properties,
altered morphological characteristics, sterility, other agronomic traits,
traits for industrial uses, or traits for improved consumer appeal.
[0024] In some embodiments of the invention, the ACCase sequence variant
included within the method includes a variation at least one of position:
1756, 1781, 1999, 2027, 2041, 2078, 2099 and 2096. In some embodiments,
the herbicide to which the plant is resistant is at least one selected
from the group of: alloxydim, butroxydim, cloproxydim, profoxydim,
sethoxydim, clefoxydim, clethodim, cycloxydim, tepraloxydim, tralkoxydim,
chloraizfop, clodinafop, clofop, cyhalofop, diclofop, fenoxaprop,
fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop, isoxapyrifop,
metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
[0025] In some embodiments, the identifying step included within the
method includes a process selected from: molecular detection of the
sequence variant, observation of resistance to an ACCase inhibitor, and
selection by application of an ACCase inhibitor.
[0026] Embodiments of the invention relate to a transgenic plant,
transformed with a segment of DNA comprising at least 250 bases derived
from the sequence of ATCC Deposit No. ______, and progeny plants of the
same. In some embodiments, the progeny plant is selected from: a
backcross progeny, a hybrid, a clonal progeny, and a sib-mated progeny.
In some embodiments, the segment of DNA comprises at least 250 bases
derived from SEQ ID NO: 5.
[0027] Embodiments of the invention are also directed to a transformed
cell containing a segment of DNA comprising at least 250 bases derived
from the sequence of ATCC Deposit No. ______. In some embodiments, the
segment of DNA comprises at least 250 bases derived from SEQ ID NO: 5.
[0028] In embodiments of the invention, a method of identifying a mutation
at position 1781 of the ACCase gene in a cell is provided, the method
including obtaining a genetic sample from a cell, selectively amplifying
a DNA fragment by using SV384F primer and SV348R primer in an
amplification step, and sequencing the DNA fragment to determine the
presence of absence of a mutation at position 1781 of the ACCase gene,
wherein the presence of a mutation in the DNA fragment is indicative of
the presence of the mutation at position 1781 in the cell.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Those of skill in the art will understand that the drawings,
described below, are for illustrative purposes only. The drawings are not
intended to limit the scope of the present teachings in any way.
[0030] FIG. 1 is a diagram of the fatty acid biosynthesis pathway in
plants.
[0031] FIG. 2 is an illustration of an embodiment of a herbicide selection
protocol for selecting non-transgenic herbicide-resistant plants as
disclosed herein.
[0032] FIG. 3 is a graph illustrating a sethoxydim dose-response curve for
seashore paspalum (Paspalum vaginatum).
[0033] FIG. 4 is a photograph of a sethoxydim-resistant callus of seashore
paspalum growing on callus induction medium containing sethoxydim.
[0034] FIG. 5 is a series of chromatographs illustrating the amino acid
mutation at position 1781 of the ACCase gene in an herbicide-resistant
seashore paspalum plant selected as disclosed herein.
[0035] FIG. 6 is a photograph illustrating the response of control plants
and herbicide-resistant plants, selected as disclosed herein, to
Segment.TM. sethoxydim at 7 days after treatment (DAT).
[0036] FIG. 7 is graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein, by Segment.TM.
sethoxydim at 7 days after treatment (DAT).
[0037] FIG. 8 is a photograph illustrating the response of control plants
and herbicide-resistant plants, selected as disclosed herein, to
Segment.TM. sethoxydim at 14 days after treatment (DAT).
[0038] FIG. 9 is graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein. by Segment.TM.
sethoxydim at 14 days after treatment (DAT).
[0039] FIG. 10 is a photograph illustrating the response of control plants
and herbicide-resistant plants, selected as disclosed herein, to
Segment.TM. sethoxydim at 21 days after treatment (DAT).
[0040] FIG. 11 is graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein, by Segment.TM.
sethoxydim at 21 days after treatment (DAT).
[0041] FIG. 12 is a graph that illustrates the mean dry weight of control
plants and herbicide-resistant plants, selected as disclosed herein,
after treatment with Segment.TM. sethoxydim at 42 days after treatment
(DAT).
[0042] FIG. 13 is a graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein, by Poast.TM.
sethoxydim at 21 days after treatment (DAT).
[0043] FIG. 14 is a graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein, by Fusilade
II.TM. fluazifop-p-butyl herbicide at 21 days after treatment (DAT).
[0044] FIG. 15 is a graph that illustrates injury to control plants and
herbicide-resistant plants, selected as disclosed herein, by Acclaim
Extra.TM. II fenoxaprop-p-butyl herbicide at 21 days after treatment
(DAT).
[0045] FIG. 16 is an illustration of an embodiment of callus production
obtained from the intercalary meristem of a plant.
DETAILED DESCRIPTION
[0046] Resistance to selective grass herbicides can provide a highly
effective means of controlling weedy grasses in various turf grass
species. Genetic engineering approaches have been proposed for the
development of herbicide-resistant plants, however, these can be
difficult to commercialize due to governmental regulations and
restrictions regarding the use of genetically modified plants. In
contrast, environmental release of plants with herbicide resistance
derived by non-transgenic means is not currently subjected to strict
governmental regulation. Accordingly, embodiments of the invention relate
to methods of screening and selecting herbicide-resistant turf grass
plants, including methods that are effective without transgenesis.
Definitions
[0047] Unless otherwise noted, terms are to be understood according to
conventional usage by those of ordinary skill in the relevant art.
[0048] As used herein, the term "explant" refers to a plant tissue that
includes meristematic tissue. It can also refer to plant tissues that
include, without limitation, one or more embryos, cotyledons, hypocotyls,
leaf bases, mesocotyls, plumules, protoplasts and embryonic axes.
[0049] As used herein, the term "callus" refers to an undifferentiated
plant cell mass that can be grown or maintained in a culture medium to
produce genetically identical cells.
[0050] As used herein, the term "herbicide-resistant" or
"herbicide-tolerant," including any of their variations, refers to the
ability of a plant to recover from, survive and/or thrive after contact
with an herbicide in an amount that is sufficient to cause retardation of
growth or death of a non-resistant plant of the same species. Typically,
amounts of herbicide sufficient to cause growth or death of a
non-resistant plant ranges from about 2 .mu.M to about 100 .mu.M of
herbicide concentration. In some embodiments, a sufficient amount of
herbicide ranges from about 5 .mu.M to about 50 .mu.M of herbicide
concentration, from about 8 .mu.M to about 30 .mu.M of herbicide
concentration, or from about 10 .mu.M to about 25 .mu.M of herbicide
concentration. Alternatively, amounts of herbicide sufficient to cause
growth or death of a non-resistant plant ranges from about 25 grams
active ingredient per hectare (g ai ha.sup.-1) to about 6500 g ai
ha.sup.-1 of herbicide application. In some embodiments, a sufficient
amount of herbicide ranges from about 50 g ai ha.sup.-1 to about 5000 g
ai ha.sup.-1 of herbicide application, about 75 g ai ha.sup.-1 to about
2500 g ai ha.sup.-1 of herbicide application, about 100 g ai ha.sup.-1 to
about 1500 g ai ha.sup.-1 of herbicide application, or about 250 g ai
ha.sup.-1 to about 1000 g ai ha.sup.-1 of herbicide application.
[0051] As used herein, the term "marker-assisted selection" refers to to
the process of selecting a desired trait or desired traits in a plant or
plants by detecting one or more markers in linkage with the desired
trait. Such markers can be phenotypic markers such as, for example,
resistance to an herbicide or antibiotic. Likewise, such markers can be
molecular markers such as, for example, one or more polymorphisms (as
described below), DNA or RNA enzymes, or other sequences that are easily
detectable.
[0052] A polynucleotide "exogenous" to an individual plant is a
polynucleotide which is introduced into the plant by any means other than
by a sexual cross. Examples of means by which this can be accomplished
are described below, and include transformation, biolistic methods,
electroporation, and the like. Such a plant containing the exogenous
nucleic acid is referred to here as R.sub.0 (for plants regenerated from
transformed cells in vitro) generation transgenic plant. R.sub.0 can also
refer to any other regenerated plant whether transgenic or not.
[0053] As used herein, the term "transgenic" describes a non-naturally
occurring plant that contains a genome modified by man, wherein the plant
includes in its genome an exogenous nucleic acid molecule, which can be
derived from the same or a different species, including non-plant
species. The exogenous nucleic acid molecule can be a gene regulatory
element such as a promoter, enhancer, or other regulatory element, or can
contain a coding sequence, which can be linked to a native or
heterologous gene regulatory element. Transgenic plants that arise from
sexual cross or by selfing are descendants of such a plant.
[0054] As used herein, "polymorphism" means the presence of one or more
variations of a nucleic acid sequence at one or more loci in a population
of one or more individuals. The variation can comprise, but is not
limited to, one or more base changes, the insertion of one or more
nucleotides, or the deletion of one or more nucleotides. A polymorphism
includes a single nucleotide polymorphism (SNP), a simple sequence repeat
(SSR), indels (insertions and deletions), a restriction fragment length
polymorphism, a haplotype, and a tag SNP. In addition, a polymorphism can
include a genetic marker, a gene, a DNA-derived sequence, a RNA-derived
sequence, a promoter, a 5' untranslated region of a gene, a 3'
untranslated region of a gene, microRNA, siRNA, a quantitative trait
locus (QTL), a satellite marker, a transgene, mRNA, ds mRNA, a
transcriptional profile, or a methylation pattern. A polymorphism can
arise from random processes in nucleic acid replication, through
mutagenesis, as a result of mobile genomic elements, from copy number
variation and during the process of meiosis, such as unequal crossing
over, genome duplication and chromosome breaks and fusions. The variation
can be commonly found or can exist at low frequency within a population,
the former having greater utility in general plant breeding and the later
can be associated with rare but important phenotypic variation.
[0055] As used herein, a "marker" refers to a polymorphic nucleic acid
sequence or nucleic acid feature. In a broader aspect, a "marker" can be
a detectable characteristic that can be used to discriminate between
heritable differences between organisms. Examples of such characteristics
can include genetic markers, protein composition, protein levels, oil
composition, oil levels, carbohydrate composition, carbohydrate levels,
fatty acid composition, fatty acid levels, amino acid composition, amino
acid levels, biopolymers, pharmaceuticals, starch composition, starch
levels, fermentable starch, fermentation yield, fermentation efficiency,
energy yield, secondary compounds, metabolites, morphological
characteristics, and agronomic characteristics.
[0056] As used herein, a "marker assay" refers to a method for detecting a
polymorphism at a particular locus using a particular method, e.g.
measurement of at least one phenotype (such as seed color, flower color,
or other visually detectable trait), restriction fragment length
polymorphism (RFLP), single base extension, electrophoresis, sequence
alignment, allelic specific oligonucleotide hybridization (ASO), random
amplified polymorphic DNA (RAPD), microarray-based technologies, and
nucleic acid sequencing technologies, etc.
[0057] As used herein, a "genotype" refers to the genetic component of the
phenotype, and this can be indirectly characterized using markers or
directly characterized by nucleic acid sequencing. Suitable markers
include a phenotypic character, a metabolic profile, a genetic marker, or
some other type of marker. A genotype can constitute an allele for at
least one genetic marker locus or a haplotype for at least one haplotype
window. In some embodiments, a genotype can represent a single locus, and
in others it can represent a genome-wide set of loci. In some
embodiments, the genotype can reflect the sequence of a portion of a
chromosome, an entire chromosome, a portion of the genome, and the entire
genome.
[0058] As used herein, "quantitative trait locus (QTL)" refers to a locus
that controls to some degree numerically representable traits that are
usually continuously distributed.
[0059] As used herein, a "nucleic acid sequence fragment" refers to a
portion of a nucleotide sequence of a polynucleotide or a portion of an
amino acid sequence of a polypeptide. Fragments of a nucleotide sequence
can encode protein fragments that retain the biological activity of the
native or corresponding full-length protein. Fragments of a nucleotide
sequence can range from at least about 20 nucleotides, about 50
nucleotides, about 100 nucleotides, about 250 nucleotides and up to the
full-length nucleotide sequence of genes or sequences encoding proteins
as disclosed herein.
Suitable Plants for Screening
[0060] Embodiments of the invention are directed to herbicide-resistant
plants from the group Panicodae regenerated from an herbicide-resistant
cell that has undergone a herbicide selection process as well as methods
of identifying the same. The plant can be, for example, one selected from
the group of: an Isachneae tribe, a Neurachneae tribe, an Arundinellaeae
tribe, and a Paniceae tribe. In some embodiments, the plant can be any
member of a genus selected from the list provided in Table A or Table B.
An exemplary, non-exhaustive list of plants suitable for use in the
invention include members of the paniceae tribe, such as: Carpetgrass,
Crabgrass, Bahiagrass, St. Augustine grass and millets, including Foxtail
(Setaria italical), Pearl (Pennisetum glaucum), and Proso (Panicum
miliaceum; commonly referred to as "common" millet, broom corn millet,
hog millet or white millet).
[0061] In some embodiments, the plant is a turfgrass species having
commercial value in applications such as, for example, golf courses,
athletic fields, commercial landscaping, commercial or home lawns, and
pastures. Exemplary turfgrass species include, but are not limited to,
seashore paspalum (Paspalum vaginatum), bahiagrass (Paspalum notatum),
bermudagrass (Cynodon spp.), blue gramma grass, buffalograss (Buchloe
dactyloides), carpetgrass (Axonopus spp.), centipedegrass (Eremochloa
ophiuroides), kikuyugrass, sideoats grama, St. Augustine grass
(Stenotaphrum secondatum), Zoysiagrass, annual bluegrass, annual
ryegrass, Canada bluegrass, chewings fescue, colonial bentgrass, creeping
bentgrass, crested wheatgrass, fairway wheatgrass, hard fescue, Kentucky
bluegrass, Texas bluegrass, orchard grass, perennial ryegrass, red
fescue, redtop, rough bluegrass, sheep fescue, smooth bromegrass, tall
fescue, Timothygrass, velvet bentgrass, weeping alkaligrass, western
wheatgrass, and the like.
TABLE-US-00001
TABLE A
Genus members (organized by tribe) of Group Panicodae
Tribe: Isachneae Tribe: Neurachneae Tribe: Arundinelleae
Coelachne Neurachne Arundinella
Cyrtococcum Paraneurachne Chandrasekharania
Heteranthoecia Thyridolepis Danthoniopsis
Hubbardia Diandrostachya
Isachne Dilophotriche
Limnopoa Garnotia
Sphaerocaryum Gilgiochloa
Isalus
Jansenella
Loudetia
Loudetiopsis
Trichopteryx
Tristachya
Zonotriche
TABLE-US-00002
TABLE B
Genus members of tribe Paniceae of Group Panicodae
Tribe: Paniceae
Achlaena
Acostia
Acritochaete
Acroceras
Alexfloydia
Alloteropsis
Amphicarpum
Ancistrachne
Anthaenantiopsis
Anthenantia
Anthephora
Arthragrostis
Arthropogon
Axonopus
Baptorhachis
Beckeropsis
Boivinella
Brachiaria
Calyptochloa
Camusiella
Cenchrus
Centrochloa
Chaetium
Chaetopoa
Chamaeraphis
Chasechloa
Chloachne
Chlorocalymma
Cleistochloa
Cliffordiochloa
Commelinidium
Cymbosetaria
Cyphochlaena
Dallwatsonia
Dichanthelium
Digitaria
Digitariopsis
Dimorphochloa
Dissochondrus
Eccoptocarpha
Echinochloa
Echinolaena
Entolasia
Eriochloa
Fasciculochloa
Gerritea
Holcolemma
Homolepis
Homopholis
Hydrothauma
Hygrochloa
Hylebates
Hymenachne
Ichnanthus
Ixophorus
Lasiacis
Lecomtella
Leptocoryphium
Leptoloma
Leucophrys
Louisiella
Megaloprotachne
Melinis
Mesosetum
Microcalamus
Mildbraediochloa
Odontelytrum
Ophiochloa
Oplismenopsis
Oplismenus
Oryzidium
Otachyrium
Ottochloa
Panicum
Paratheria
Parectenium
Paspalidium
Paspalum
Pennisetum
Perulifera
Plagiantha
Plagiosetum
Poecilostachys
Pseudechinolaena
Pseudochaetochloa
Pseudoraphis
Reimarochloa
Reynaudia
Rhynchelytrum
Sacciolepis
Scutachne
Setaria
Setariopsis
Snowdenia
Spheneria
Spinifex
Steinchisma
Stenotaphrum
Stereochlaena
Streptolophus
Streptostachys
Taeniorhachis
Tarigidia
Tatianyx
Thrasya
Thrasyopsis
Thuarea
Thyridachne
Trachys
Tricholaena
Triscenia
Uranthoecium
Urochloa
Whiteochloa
Xerochloa
Yakirra
Yvesia
Zygochloa
[0062] In embodiments of the invention, the plant to be subjected to the
method(s) of the invention can be one found in nature, a cultivated
nontransgenic plant, or a plant that has been modified through genetic
means, such as, for example, a transgenic plant.
Callus Source
[0063] Explant selections can be harvested from any portion of the plant
that produces a callus or a mass of undifferentiated cells that can be
cultured in vitro. For example, an explant selection can be obtained from
the intercalary meristem tissue of a plant, immature inflorescences, or
leaf meristematic tissue. In some embodiments, the explant selection can
be obtained from a seed of a plant, or fragment or section thereof.
[0064] Prior to explant acquisition, the source tissue or seed can be
subjected to a sterilization step to avoid microbial contamination in
vitro. Sterilization can include rinsing in a bleach solution, such as,
for example, a solution of from about 10% (v/v) to 100% (v/v), rinsing in
an alcohol solution (e.g. ethanol), such as, for example, a solution of
from about 50% (v/v) to 95% (v/v), and/or rinsing in sterile deionized
water. The sterilization step can take place at any temperature that is
not lethal to the plant material, preferably from about 20.degree. C. to
about 42.degree. C.
[0065] Dry explants (explants that have been excised from seed under low
moisture conditions) or dried wet explants (explants that have been
excised from seed following hydration/imbibition and are subsequently
dehydrated and stored) of various ages can be used. In some embodiments,
explants are relatively "young" in that they have been removed from seeds
for less than a day, for example, from about 1 to 24 hours, such as about
2, 3, 5, 7, 10, 12, 15, 20, or 23 hours prior to use. In some
embodiments, explants can be stored for longer periods, including days,
weeks, months or even years, depending upon storage conditions used to
maintain explant viability. Those of skill in the art can understand that
storage times can be optimized such efficient callus formation can be
obtained.
[0066] In some embodiments, a dry seed or an explant can first be primed,
for example, by imbibition of a liquid such as water or a sterilization
liquid, redried, and later used for production of callus tissue.
[0067] The explant can be recovered from a hydrated seed, from dry
storable seed, from a partial rehydration of dried hydrated explant,
wherein "hydration" and "rehydration" is defined as a measurable change
in internal seed moisture percentage, or from a seed that is "primed;"
that is, a seed that has initiated germination but has been appropriately
placed in stasis pending favorable conditions to complete the germination
process. Those of skill in the art will be able to use various hydration
methods and optimize length of incubation time prior to callus tissue
induction. The resulting novel explant is storable and can germinate
and/or be used to induce callus formation when appropriate conditions are
provided. Thus the new dry, storable meristem explant can be referred to
as an artificial seed.
[0068] The explant selection is cultured in an appropriate plant culture
medium for promotion of callus formation. For example, the plant culture
medium can be MS/B5 medium (Murashige and Skoog. 1962. Physiol Plant
15:473-497; Gamborg et al. 1968. Exp Cell Res 50:151-158, each of which
is incorporated herein by reference in its entirety) supplemented with
auxins and nutrients, including amino acids, carbohydrates and salts. A
variety of tissue culture media are known that, when supplemented
appropriately, support plant tissue growth and development, including
formation of callus tissue from explant selections. These tissue culture
medium can either be purchased as a commercial preparation or custom
prepared and modified by those of skill in the art. Examples of such
media include, but are not limited to those described by Murashige and
Skoog (1962. Physiol Plant 15:473-497); Chu et al. (1975. Scientia Sinica
18:659-668); Linsmaier and Skoog (1965. Physiol Plant 18:100-127);
Uchimiya and Murashige (1962. Plant Physiol 15:73); Gamborg et al. (1968.
Exp Cell Res 50:151-158); Duncan et al. (1985. Planta 165:322-332); Lloyd
and McCown (1981. Proc-Int Plant Propagator's Soc 30:421-427); Nitsch and
Nitsch (1969. Science 163:85-87); and Schenk and Hildebrandt (1972. Can J
Bot 50:199-204); each of the foregoing is incorporated herein by
reference in its entirety. Likewise, those of skill in the art can make
derivations of these media, supplemented accordingly. Those of skill in
the art are aware that media and media supplements such as nutrients and
growth regulators for use in transformation and regeneration are often
optimized for the particular target crop or variety of interest. Tissue
culture media can be supplemented with carbohydrates such as, but not
limited to, glucose, sucrose, maltose, mannose, fructose, lactose,
galactose, and/or dextrose, or ratios of carbohydrates. Reagents are
commercially available and can be purchased from a number of suppliers
(see, for example Sigma Chemical Co., St. Louis, Mo.; and PhytoTechnology
Laboratories, Shawnee Mission, Kans.). In addition suitable auxins can
include, but are not limited to, dicamba, 2,4-dichlorophenoxyacetic acid
("2,4-D"), and the like. Callus induction formulations can depend on the
explant selection and can be selected and optimized according to
protocols that are well-known to those of skill in the art.
Evaluation of Callus Formation
[0069] The ability of each genotype to produce calli is evaluated before
the first subculture occurs. The most prolific cell lines can be
determined by observing the number of explants per genotype that produce
callus. A relative numerical scale can be applied to each callus after
approximately 30 days. For example, a numerical scale can consist of a
rating of 1 to 5, depending on the amount of the callus produced by the
explant. An exemplary rating of 5 can indicate that the explant produces
a large amount of callus tissue, whereas a rating of 1 is assigned to the
explants that have very low amounts of visible callus production. After
rating, each callus is removed and subcultured. The calli produced by
each explant can be identified as an individual cell line. Subculturing
of each callus can be conducted every two or three weeks, for example.
Evaluation of Dose Response to Herbicide
[0070] The appropriate herbicide concentration used in screening for
resistant calli is assessed by placing callus tissue of each genotype to
be tested on a series of induction medium plates with varying
concentrations of herbicide. The range of herbicide concentrations tested
in the dose-response assay is preferably 0 to 15 times the predicted
lethal dosage, more preferably 2 to 10 times the predicted lethal dosage,
and typically about 3 to 5 times the predicted lethal dosage. The
herbicide concentration to be used in screening for resistant calli can
be 30-50% greater than the minimum dosage at which there is no growth of
the control callus, as determined by the dose-response assay.
Selection of Herbicide-Resistant Cells
[0071] To select for herbicide-resistant cells, mature callus tissue can
be placed on callus induction medium containing the appropriate herbicide
concentration, as determined by the dose-response assay. Calli can be
subcultured to fresh plates as necessary during the screening process.
After resistant calli are identified, they can be subcultured onto
induction medium for additional growth, sufficient to support
regeneration.
Regeneration of Herbicide-Resistant Cells into Whole Plants
[0072] Calli are removed from plant culture medium and plated on an
appropriate regeneration medium. A variety of tissue culture media are
known that, when supplemented appropriately, support plant tissue growth,
development and regeneration. These tissue culture media can either be
purchased as a commercial preparation or custom prepared and modified by
those of skill in the art. Examples of such media include, but are not
limited to those listed hereinabove. As a nonlimiting example, Paspalum
vaginatum can be regenerated by placing calli of each resistant line on
medium consisting of MS/B5 basal medium supplemented with 1.24 mg
L.sup.-1 CuSO.sub.4, and 1.125 mg/L.sup.-1 BAP (6-benzylaminopurine). The
regeneration medium can depend on the plant tissue source, and selection
of the appropriate regeneration medium and protocol for regeneration are
known to those of skill in the art.
[0073] Regeneration can occur on either solid or liquid media in
receptacles such as, for example, petri dishes, flasks, tanks, or any
other suitable chamber for that is used for culturing. The receptacle can
optionally be sealed (e.g. with filter tape) so as to facilitate gas
exchange for the regenerating plants. Growth chamber conditions can be at
between about 20.degree. C. or less, to 40.degree. C. or more. In some
embodiments, suitable temperatures for growth can range from about
22.degree. C. to 37.degree. C., about 25.degree. C. to 35.degree. C., or
about 28.degree. C. to 32.degree. C. Dark:light exposure can range from
about 1 hour dark:23 hours light to about 12 hours dark, or more:12 hours
light, or less. In some embodiments, dark:light exposure can range from
about 2 hours dark:22 hours light, to about 10 hours dark:14 hours light,
from about 4 hours dark:20 hours light, to about 8 hours dark:16 hours
light. Dark:light exposure can be followed by any where between about 1
hour to 10 hours of darkness, about 2 hours to 8 hours of darkness, or
about 4 hours to 6 hours of darkness. In some embodiments, the dark
period can be followed by additional cycles of dark:light exposure
followed by dark exposure in any combination suitable for regeneration.
The appropriate light intensity is selected according to well-known
protocols in the art to facilitate growth. For example, to facilitate
growth and regeneration of Paspalum vaginatumi, light intensity
approximately equivalent to that provided by General Electric (GE) cool
white bulbs at an intensity of 66-95 .mu.m.sup.-2s.sup.-1 can be provided
to the growing plants.
Progeny of Regenerated Plants
[0074] Regenerated plants can be reproduced asexually or asexually. For
example, regenerated plants can be self-pollinated. In some embodiments,
pollen can be obtained from regenerated plants and crossed to seed-grown
plants of another plant having a second desired trait. In some
embodiments, pollen can be obtained from a plant having a second desired
trait and used to pollinate regenerated plants. The progeny of the
regenerated plants can be, for example, a seed or a propagative cutting,
in which the herbicide resistance of the regenerated plant is inherited
from the parent. In addition, regenerated plants can be self-crossed or
sib-crossed to develop a line of plants homozygous for the resistance
allele. In some cases such homozygous plants can have a higher level of
resistance than the originally selected, heterozygous, plants.
[0075] Vegetative propagation can be accomplished by using sod, plugs,
sprigs, and stolons. When applied to turfgrass varieties, vegetative
propagation of such grasses produces progeny that are typically clonal
(genetically identical). Clonal vegetative varieties produce a turf that
is very uniform in appearance.
[0076] Certain varieties are propagated solely by vegetative means;
exemplary varieties having this feature include ornamentals, small
fruits, and trees.
Molecular Characterization of Herbicide Resistance
[0077] Mutations leading to herbicide resistance in plants can be
characterized by extraction and subsequent PCR amplification of DNA from
plant tissue. Plant DNA can be extracted via any number of DNA extraction
methods, such as the CTAB method (Lassner, et al., 1989. Plant Mol. Biol.
Rep. 7:116-128, which is incorporated herein by reference in its
entirety), an SDS-potassium-acetate method (Dellaporta et al. 1983. Plant
Molecular Biology Reporter 1:19-21, which is incorporated herein by
reference in its entirety), direct amplification of leaf tissues
(Berthomieu and Meyer 1991. Plant Molecular Biology 17: 555-557, which is
incorporated herein by reference in its entirety), a boiling method
(Ikeda et al. 2001. Plant Molecular Biology Reporter 19(1): 27-32, which
is incorporated by reference herein in its entirety), an alkali treatment
method (Xin et al. 2003. BioTechniques 34:820-826, which is incorporated
by reference herein in its entirety), FTA.RTM. cards, or any other
effective DNA extraction protocol for plants. Primers used to initiate
PCR amplification of the regions of DNA conferring herbicide resistance
can be designed to match conserved flanking sequences of the highest
number of related species possible.
[0078] Identification of Mutations Associated with Resistance to ACCase
Inhibitor Herbicides
[0079] Plants identified as being resistant to ACCase inhibitor herbicides
by the methods disclosed herein can be evaluated for genetic mutations
within the ACCase gene. For example, in some embodiments, the genetic
mutations can lead to mutations in the ACCase protein at residues Gln
1756, Ile 1781, Trp 1999, Trp 2027, Ile 2041, Asp 2078, Cys 2088, and/or
Gly 2096. In some embodiments, substitutions at those residues can
include, but are not limited to leucine, alanine, valine, cysteine,
aspartic acid, glycine, arginine, and glutamic acid. In some embodiments,
the amino acid substitutions within the ACCase protein can be, for
example, Gln 1756 to Glu, Ile 1781 to Leu, Ile 1781 to Ala, Ile 1781 to
Val, Trp 1999 to Cys, Trp 2027 to Cys, Ile 2041 to Asp, Ile 2041 to Val,
Asp 2078 to Gly, Asp 2078 to Val, Cys 2088 to Arg, and/or Gly 2096 to
Ala, and the like. In some embodiments, the amino acid substitutions can
be a combination of two or more mutations at positions such as those
described above, involving changes such as those described above.
Likewise, in some embodiments, other conservative substitutions can be
made at these positions and/or at other positions known to those of skill
in the art to be positions of contact or interaction between an ACCase
and an ACCase inhibitor.
[0080] Mutations in the ACCase gene that lead to amino acid substitutions
in the ACC protein include those listed in Table C.
TABLE-US-00003
TABLE C
Summary of Amino Acid Substitutions Associated with ACCase Inhibitor
Herbicide Resistance
Amino Acid Residue - Position in
the CT Domain of the plastidic
ACCase protein Substitution Reference
Isoleucine - 1781 Leucine Delye et al. (2002a, 2002b, 2002c)
Christoffers et al. (2002)
White et al. (2005)
Liu et al. (2007)
Alanine
Valine Collavo et al. (2007)
Tryptophan - 1999 Cysteine Liu et al. (2007)
Tryptophan - 2027 Cysteine Delye et al. (2005)
Liu et al. (2007)
Isoleucine - 2041 Aspartic Acid Delye et al. (2003)
Liu et al. (2007)
Valine Delye et al. (2003)
Aspartic Acid - 2078 Glycine Delye et al. (2005)
Liu et al. (2007)
Valine Collavo et al. (2007)
Cysteine - 2088 Arginine Yu et al. (2007)
Glycine - 2096 Alanine Delye et al. (2005)
Glutamine - 1756 Glutamic Acid Zhang and Powles (2006)
[0081] In addition, ACCase herbicide resistance can be conferred by any
conservative substitutions at any of the referenced amino acid positions.
A table of conservative substitutions is provided in Table D.
TABLE-US-00004
TABLE D
Conservative amino acid substitutions
Group 1 Ile, Leu, Val, Ala, Gly
Group 2 Trp, Tyr, Phe
Group 3 Asp, Glu, Asn, Gln
Group 4 Cys, Ser, Thr, Met
Group 5 Pro
Group 6 His, Lys, Arg
Evaluation of Whole Plant Resistance to Herbicide
[0082] Whole plant herbicide resistance can be evaluated by comparing the
effects of herbicide exposure on herbicide-resistant cell lines with
herbicide-susceptible controls. Herbicide exposure can be accomplished by
treating herbicide-resistant plants and herbicide-susceptible control
plants with varying rates of herbicide, ranging from 0 to 20 times the
known lethal dose for the species of interest.
Herbicide Resistance
[0083] Embodiments of the invention relate to methods and compositions as
disclosed herein to develop herbicide resistance in plants for commercial
applications. In embodiments of the invention, the plants are selected
and identified for being resistant to ACCase inhibitor herbicides.
[0084] Acetyl co-enzyme A carboxylase (ACCase) is known to exist in two
forms: eukaryotic and prokaryotic. The prokaryotic form is made up of
four subunits, while the eukaryotic form is a single polypeptide with
distinct functional domains (Harwood, et al. 1988. Plant Molecular
Biology 39:101-138, which is incorporated herein by reference in its
entirety). Acetyl-coenzyme A is carboxylated by ACCase to form
malonyl-coenzyme A in the first committed step of lipid biosynthesis.
ACCase is compartmentalized in two forms in most plants (Sasaki, et al.
1995. Plant Physiology 108:445-449, which is incorporated herein by
reference in its entirety). The chloroplast is known to be the primary
site of lipid synthesis; however, ACCase can be present in the cytosol as
well. Most plants have the prokaryotic form in the chloroplast and the
eukaryotic form in the cytosol. The tetrameric prokaryotic protein is
coded for by four distinct genes, one being located in the chloroplast
genome. The eukaryotic form is encoded by a nuclear gene approximately
12,000 bp in size (Podkowinski, et al. 1996. PNAS 93:1870-1874, which is
incorporated herein by reference in its entirety). Grasses are unique in
that eukaryotic forms of ACCase are found in both the cytosol and
chloroplast (Sasaki, et al. 1995. supra). The plastidic and cytosolic
eukaryotic forms of ACCase in grasses are very similar, as are the genes
that code for them (Gornicki, et al. 1994. PNAS 91:6860-6864, which is
incorporated herein by reference in its entirety). However, despite the
fact that there is homology between the plastidic and cystolic eukaryotic
forms of ACCase, the cystolic form is not affected by ACCase-inhibiting
herbicides (Delye. 2005. Plant Physiology 137:794-806, which is
incorporated herein by reference in its entirety).
[0085] Herbicides that act as acetyl-coenzyme A carboxylase (ACCase)
inhibitors interrupt lipid biosynthesis in plants, which can lead to
membrane destruction actively growing areas such as meristematic tissue.
ACCase inhibitors are exemplified by the aryloxyphenoxypropionate (APP)
chemical family, also known as FOPS, and the cyclohexandione (CHD)
family, also known as DIMs.
[0086] Accordingly, embodiments of the invention are directed to plants
selected for resistance to ACCase inhibitor herbicides and methods of
identifying the same. In some embodiments, the plant is resistant to a
cyclohexanedione herbicide, an aryloxyphenoxy proprionate herbicide, a
phenylpyrazoline herbicide, or mixtures thereof. In some embodiments, the
plant is resistant to at least one herbicide selected from the list
provided in Table E.
TABLE-US-00005
TABLE E
Acetyl Coenzyme A Carboxlyase Inhibitors
Herbicide Class
(Synonyms) Active Name Synonyms Example Products
Cyclohexanediones Alloxydim Carbodimedon, Fervin, Kusagard
(CHDs, DIMs) Zizalon,
BAS 90210H
Butroxydim Butoxydim Falcon
Clethodim Cletodime Select; Prism;
Centurion; Envoy
Cloproxydim Selectone
Cycloxydim BAS 517H, BAS 517 Focus; Laser; Stratos
Profoxydim Clefoxydim; Aura
BAS 625 H
Sethoxydim Cyethoxydim Poast; Rezult;
Vantage;
Checkmate, Expand,
Fervinal, Grasidim,
Sertin
Tepraloxydim Caloxydim Aramo; Equinox
Tralkoxydim Tralkoxydime; Achieve; Splendor;
Tralkoxidym Grasp
Aryloxyphenoxy Chlorazifop
propionates (APPs, Clodinafop Discover, Topik
FOPs) Clofop Fenofibric Acid Alopex
Cyhalofop Barnstorm; Clincher
Diclofop Dichlorfop; Illoxan Hoelon; Hoegrass;
Illoxan
Fenoxaprop Fenoxaprop-P Option; Acclaim;
Fusion w/ Fluazifop
Fenthiaprop Fenthioprop; Taifun; Joker; Hoe
Fentiaprop 35609
Fluazifop Fluazifop-P Fusilade DX; Fusion
w/ Fenoxaprop
Haloxyfop Haloxyfop-P Edge; Motsa;
Verdict; Gallant
Isoxapyrifop HOK-1566; RH-
0898
Metamifop
Propaquizafop Correct; Shogun;
Agil
Quizalofop Quizalofop-P; Assure; Targa
Quizafop
Trifop
Phenylpyrazoline Pinoxaden Only known ACCase Axial
(DENs) inhibitor in its class
[0087] Herbicidal cyclohexanediones include, but are not limited to,
sethoxydim
(2-[1-(ethoxyimino)-butyl]-5-[2-(ethylthio)propyl]-3-hydroxy-2-cylohexen--
1-one, commerically available from BASF (Parsippany, N.J.) under the
designation POAST.TM.), clethodim
((E,E)-(.+-.)-2-[1-[[(3-chloro-2-propenyl)oxy]imino]propyl]-5-[2-(ethylth-
io)propyl]-3-hydroxy-2-cyclohexen-1-one; available as SELECT.TM. from
Chevron Chemical (Valent) (Fresno, Calif.)), cloproxydim
((E,E)-2-[1-[[(3-chloro-2-propenyl)oxy]imino]butyl]-5-[2-(ethylthio)propy-
l]-3-hydroxy-2-cyclohexen-1-one; available as SELECTONE.TM. from Chevron
Chemical (Valent) (Fresno, Calif.)), and tralkoxydim
(2-[1-(ethoxyimino)propyl]-3-hydroxy-5-mesitylcyclohex-2-enone, available
as GRASP.TM. from Dow Chemical USA (Midland, Mich.)). Additional
herbicidal cyclohexanediones include, but are not limited to, clefoxydim,
cycloxydim, and tepraloxydim.
[0088] Herbicidal aryloxyphenoxy proprionates and/or
aryloxyphenoxypropanoic acids exhibit general and selective herbicidal
activity against plants. In these compounds, the aryloxy group can be
phenoxy, pyridinyloxy or quinoxalinyl. Herbicidal aryloxyphenoxy
proprionates include, but are not limited to, haloxyfop
((2-[4-[[3-chloro-5-(trifluoromethyl)-2-pyridinyl]oxy]phenoxy]-propanoic
acid), which is available as VERDICT.TM. from Dow Chemical U.S.A.
(Midland, Mich.)), diclofop
(((.+-.)-2-[4-(2,4-dichlorophenoxy)-phenoxy]propanoic acid), available as
HOELON.TM. from Hoechst-Roussel Agri-Vet Company (Somerville, N.J.)),
fenoxaprop ((.+-.)-2-[4-[(6-chloro-2-benzoxazolyl)oxy]phenoxy]propanoic
acid; available as WHIP.TM. from Hoechst-Roussel Agri-Vet Company
(Somerville, N.J.)); fluazifop
((.+-.)-2-[4-[[5-(trifluoromethyl)-2-pyridinyl]oxy]phenoxy]propanoic
acid; available as FUSILADE.TM. from ICI Americas (Wilmington, Del.)),
fluazifop-P((R)-2-[4-[[5-(trifluoromethyl)-2-pyridinyl]oxy]phenoxy]propan-
oic acid; available as FUSILADE 2000.TM. from ICI Americas (Wilmington,
Del.)), quizalofop
((.+-.)-2-[4-[(6-chloro-2-quinoxalinyl)-oxy]phenoxy]propanoic acid;
available as ASSURE.TM. from E. I. DuPont de Nemours (Wilmington, Del.)),
and clodinafop.
[0089] Analogs of Herbicidal Cyclohexanediones or Herbicidal Aryloxphenoxy
Proprionates or Herbicidal Phenylpyrazolines
[0090] Included among the ACCase inhibitors are herbicides that are
structurally related to the herbicidal cyclohexanediones, herbicidal
aryloxyphenoxy proprionates, or herbicidal phenylpyrazolines, as herein
disclosed, such as, for example, analogs, metabolites, intermediates,
precursors, salts, and the like.
Transformation with a Gene of Interest
[0091] In the methods disclosed herein, particular fragments of DNA have
been isolated and cloned into vectors for the purposes of transforming
plant tissue or cells. For example, a 384 base pair fragment has been
isolated from the ACCase gene of Line A (Examples), in which an
isoleucine to leucine mutation at position 1781 of the ACCase protein
("Ile1781Leu" or "I1781L") has been identified. Such identified fragments
can be used for transformation of plant tissues and cells as disclosed
herein.
[0092] Various methods have been developed for transferring genes into
plant tissue, including, but not limited to, high velocity
microprojection, microinjection, electroporation, direct DNA uptake and,
bacterially-mediated transformation. Bacteria known to mediate plant cell
transformation include a number of species of the Rhizobiaceae,
including, but not limited to, Agrobacterium sp., Sinorhizobium sp.,
Mesorhizobium sp., and Bradyrhizobium sp. (e.g. Broothaerts et al., 2005.
Nature 433:629-633 and U.S. Patent Application Publication 2007/0271627,
each of which is incorporated herein by reference in its entirety).
Targets for such transformation can be undifferentiated callus tissues,
differentiated tissue, a population of cells derived from a specific cell
line, and the like. Co-culture and subsequent steps can be performed in
dark conditions, or in the light, e.g. lighted Percival incubators, for
instance for 2 to 5 days (e.g. a photoperiod of 16 hours of light/8 hours
of dark, with light intensity of .gtoreq.5 .mu.E, such as about 5-200
.mu.E or other lighting conditions that allow for normal plastid
development) at a temperature of approximately 23.degree. C. or less to
25.degree. C., and can be performed at up to about 35.degree. C. or
40.degree. C. or more.
[0093] The vector containing the isolated DNA fragment can contain a
number of genetic components to facilitate transformation of the plant
cell or tissue and regulate expression of the structural nucleic acid
sequence.
[0094] In some embodiments, the vector can contain a selectable,
screenable, or scoreable marker gene. These genetic components are also
referred to herein as functional genetic components, as they produce a
product that serves a function in the identification of a transformed
plant, or a product of agronomic utility. The DNA that serves as a
selection or screening device can function in a regenerable plant tissue
to produce a compound that would confer upon the plant tissue resistance
to an otherwise toxic compound. A number of screenable or selectable
marker genes are known in the art and can be used in the present
invention. Genes of interest for use as a marker would include but are
not limited to GUS, green fluorescent protein (GFP), luciferase (LUX),
and the like. Additional exemplary markers are known and include
.beta.-glucuronidase (GUS) that encodes an enzyme for various chromogenic
substrates (Jefferson et al. 1987. Biochem Soc Trans 15:7-19; Jefferson
et al. 1987. EMBO J. 6:3901-3907, each of which are incorporated herein
by reference in its entirety); an R-locus gene, that encodes a product
that regulates the production of anthocyanin pigments (red color) in
plant tissues (Dellaporta et al. 1988. In: Chromosome Structure and
Function: Impact of New Concepts. 18.sup.th Stadler Genetics Symposium
11:283-282, which is incorporated herein b reference in its entirety); a
.beta.-lactamase gene (Sutcliffe et al. 1978. Proc Natl Acad Sci USA
75:3737-3741, which is incorporated herein by reference in its entirety);
a gene that encodes an enzyme for that various chromogenic substrates are
known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow
et al. 1986. Science 234:856-859, which is incorporated herein by
reference in its entirety); a xy1E gene (Zukowsky et al. 1983. Proc Natl
Acad Sci USA 80:1101-1105, which is incorporated herein by reference in
its entirety) that encodes a catechol dioxygenase that can convert
chromogenic catechols; an .alpha.-amylase gene (Ikatu et al. 1990.
Bio/Technol 8:241-242, which is incorporated herein by reference in its
entirety); a tyrosinase gene (Katz et al. 1983. J Gen Microbiol
129:2703-2714, which is incorporated herein by reference in its entirety)
that encodes an enzyme capable of oxidizing tyrosine to DOPA and
dopaquinone that in turn condenses to melanin; green fluorescence protein
(Elliot et al. 1999. Plant Cell Rep 18:707-714, which is incorporated
herein by reference in its entirety) and an .alpha.-galactosidase. As is
well known in the art, other methods for plant transformation can be
utilized, for instance as described by Miki et al. (1993. In: Methods in
Plant Molecular Biology and Biotechnology, Glick and Thompson (eds.), CRC
Press, Inc.: Boca Raton, pp. 67-88, which is incorporated herein by
reference in its entirety), including use of microprojectile bombardment
(e.g. U.S. Pat. No. 5,914,451; McCabe et al. 1991. Bio/Technology
11:596-598; U.S. Pat. No. 5,015,580; U.S. Pat. No. 5,550,318; and U.S.
Pat. No. 5,538,880; each of the foregoing is incorporated herein by
reference in its entirety).
[0095] Transgenic plants can be regenerated from a transformed plant cell
by methods and compositions known in the art. For example, a transgenic
plant formed using Agrobacterium transformation methods typically
contains a single simple recombinant DNA sequence inserted into one
chromosome and is referred to as a transgenic event. Such transgenic
plants can be referred to as being heterozygous for the inserted
exogenous sequence. A transgenic plant homozygous with respect to a
transgene can be obtained by sexually mating (selfing) an independent
segregant transgenic plant that contains a single exogenous gene sequence
to itself, for example an R.sub.0 plant, to produce R.sub.1 seed. One
fourth of the R.sub.1 seed produced will be homozygous with respect to
the transgene. Germinating R.sub.1 seed results in plants that can be
tested for zygosity, typically using a SNP assay or a thermal
amplification assay that allows for the distinction between heterozygotes
and homozygotes (i.e., a zygosity assay). Alternatively, R.sub.2 progeny
can be developed and tested from several R.sub.1 plants, wherein a
homogeneous R.sub.2 progeny, with all individuals resistant, is
indicative of a homozygous R.sub.1 parent.
[0096] To confirm the presence of the exogenous DNA or "transgene(s)" in
the transgenic plants, a variety of assays can be performed. Such assays
include, for example, "molecular biological" assays, such as Southern and
northern blotting and PCR, INVADER.TM. assays; "biochemical" assays, such
as detecting the presence of a protein product, e.g., by immunological
means (ELISAs and western blots) or by enzymatic function; plant part
assays, such as leaf or root assays; and also, by analyzing the phenotype
of the whole regenerated plant.
[0097] Once a mutation has been selected for and confirmed in a plant, or
once a transgene has been introduced into a plant, that mutation or
transgene can be introduced into any plant that is sexually compatible
with the first plant by crossing, without the need for directly selecting
mutants in, or transforming, the second plant. Therefore, as used herein
the term "progeny" can denote the offspring of any generation descended
from a parent plant prepared in accordance with the instant invention,
wherein the progeny comprises a desired genotype or phenotype, whether
transgenic or non-transgenic. A "transgenic plant," depending upon
conventional usage and/or regulatory definitions, can thus be of any
generation. "Crossing" a plant to provide a plant line having one or more
selected mutations, phenotypes, and/or added transgenes or alleles
relative to a starting plant line can result in a particular sequence
being introduced into a plant line by crossing a starting or base plant
line with a donor plant line that comprises a mutant allele, a transgene,
or the like. To achieve this one can, for example, perform the following
steps: (a) plant seeds of the first (starting line) and second (donor
plant line that comprises a desired transgene or allele) parent plants;
(b) grow the seeds of the first and second parent plants into plants that
bear flowers; (c) pollinate a flower from the first parent plant with
pollen from the second parent plant; and (d) harvest seeds produced on
the parent plant bearing the fertilized flower.
Methods of Controlling Weedy Grasses and Selectively Growing
Herbicide-Resistant Plants
[0098] Exclusion of undesirable weedy grasses can be accomplished by
treating the area in which exclusive growth of resistant plant species is
desired, with herbicides to which resistance has been established.
Accordingly, embodiments of the invention also relate to methods of
controlling weeds in the vicinity of an herbicide-resistant plant
identified by the methods disclosed herein, including: contacting at
least one herbicide to the weeds and to the herbicide-resistant plant,
wherein the at least one herbicide is contacted to the weeds and to the
plant at a rate sufficient to inhibit growth or cause death of a
non-selected plant of the same species and/or of a weed species desired
to be suppressed. The non-selected plant typically is non-resistant to
the herbicide.
[0099] In some embodiments, the herbicide can be contacted directly to the
herbicide-resistant plant and to the weeds. For example, the herbicide
can be dusted directly over the herbicide-resistant plant and the weeds.
Alternatively, the herbicide can be sprayed directly on the
herbicide-resistant plant and the weeds. Other means by which the
herbicide can be applied to the herbicide-resistant plant and weeds
include, but are not limited to, dusting or spraying over an area or plot
of land containing the herbicide-resistant plant and the weeds.
[0100] In some embodiments, the herbicide can be contacted or added to a
growth medium in which the herbicide-resistant plant and the weeds are
located. The growth medium can be, but is not limited to, soil, peat,
dirt, mud, or sand. In other embodiments, the herbicide can be included
in water with which the plants are irrigated.
[0101] Typically, amounts of herbicide sufficient to cause growth or death
of a non-resistant or non-selected plant ranges from about 2 .mu.M or
less to about 100 .mu.M or more of herbicide concentration. In some
embodiments, a sufficient amount of herbicide ranges from about 5 .mu.M
to about 50 .mu.M of herbicide concentration, from about 8 .mu.M to about
30 .mu.M of herbicide concentration, or from about 10 .mu.M to about 25
.mu.M of herbicide concentration. Alternatively, amounts of herbicide
sufficient to cause growth or death of a non-resistant plant ranges from
about 25 grams of active ingredient per hectare (g ai ha.sup.-1) to about
6500 g ai ha.sup.-1 of herbicide application. In some embodiments, a
sufficient amount of herbicide ranges from about 50 g ai ha.sup.-1 to
about 5000 g ai ha.sup.-1 of herbicide application, about 75 g ai
ha.sup.-1 to about 2500 g ai ha.sup.-1 of herbicide application, about
100 g ai ha.sup.-1 to about 1500 g ai ha.sup.-1 of herbicide application,
or about 250 g ai ha.sup.-1 to about 1000 g ai ha.sup.-1 of herbicide
application.
Marker-Assisted Selection Methods
[0102] Marker-assisted selection (MAS), also known as molecular breeding
or marker-assisted breeding (MAB), refers to to the process of selecting
a desired trait or desired traits in a plant or plants by detecting one
or more markers in the plant, where the marker is in linkage with the
desired trait. In some embodiments, the marker used for MAS is a
molecular marker. In other embodiments, it is a phenotypic marker, as
discussed above.
[0103] In molecular breeding programs, genetic marker alleles can be used
to identify plants that contain a desired genotype at one marker locus,
several loci, or a haplotype, and that would therefore be expected to
transfer the desired genotype, along with an associated desired
phenotype, to their progeny. Markers are useful in plant breeding
because, once established, they are not subject to environmental or
epistatic interactions. Furthermore, certain types of markers are suited
for high throughput detection, enabling rapid identification in a cost
effective manner.
[0104] Due to allelic differences in molecular markers, quantitative trait
loci (QTL) can be identified by statistical evaluation of the genotypes
and phenotypes of segregating populations. Processes to map QTL are well
known in the art and described in, for example, WO 90/04651; U.S. Pat.
No. 5,492,547, U.S. Pat. No. 5,981,832, U.S. Pat. No. 6,455,758;
Flint-Garcia et al. 2003 Ann. Rev. Plant Biol. 54:357-374, each of the
foregoing which is incorporated herein by reference in its entirety.
Using markers to infer phenotype in these cases results in the
economization of a breeding program by substitution of costly,
time-intensive phenotyping with genotyping. Marker approaches allow
selection to occur before the plant reaches maturity, thus saving time
and leading to efficient use of plots. Selection can also occur at the
seed level such that preferred seeds are planted (U.S. Patent Publication
No. 2005/000213435 and U.S. Patent Publication No. 2007/000680611, each
of the foregoing which is incorporated herein by reference in its
entirety). Further, breeding programs can be designed to explicitly drive
the frequency of specific, favorable phenotypes by targeting particular
genotypes (U.S. Pat. No. 6,399,855, which is incorporated herein by
reference in its entirety). Fidelity of these associations can be
monitored continuously to ensure maintained predictive ability and, thus,
informed breeding decisions (U.S. Patent Application 2005/0015827, which
is incorporated herein by reference in its entirety).
[0105] Accordingly, embodiments of the invention are directed to methods
of marker-assisted breeding, including identifying a feature of interest
for breeding and selection, wherein the feature is in linkage with an
ACCase gene, providing a first plant carrying an ACCase sequence variant
capable of conferring upon the plant resistance to an ACCase-inhibitor
herbicide, wherein the plant further comprises the feature of interest,
breeding the first plant with a second plant, identifying progeny of the
breeding step as having the ACCase sequence variant, and selecting
progeny likely to have the feature of interest based upon the identifying
step. The feature of interest can be any one or more selected from the
group of: herbicide tolerance, disease resistance, insect of pest
resistance, altered fatty acid, protein or carbohydrate metabolism,
increased growth rates, enhanced stress tolerance, preferred maturity,
enhanced organoleptic properties, altered morphological characteristics,
sterility, other agronomic traits, traits for industrial uses, or traits
for improved consumer appeal.
[0106] In some embodiments, nucleic acid-based analyses for the presence
or absence of the genetic polymorphism can be used for the selection of
seeds or plants in a breeding population. The analysis can be used to
select for genes, QTL, alleles, or genomic regions (haplotypes) that
comprise or are linked to a genetic marker. For example, the marker can
be the ACCase sequence variant that includes a variation corresponding to
at least one amino acid position in the ACCase protein selected from the
group of: Gln 1756, Ile 1781, Trp 1999, Trp 2027, Ile 2041, Asp 2078, Cys
2088 and Gly 2096. In some embodiments, the variation can be at least one
selected from the group of: Gln1756Glu, Ile1781Leu, Ile1781Ala,
Ile1781Val, Trp1999Cys, Trp2027Cys, Ile2041Asp, Ile2041Val, Asp2078Gly,
Asp2078Val, Cys2088Arg and Gly2096Ala. Nucleic acid analysis methods are
known in the art and include, but are not limited to, PCR-based detection
methods (for example, TaqMan assays), microarray methods, and nucleic
acid sequencing methods. In some embodiments, the detection of
polymorphic sites in a sample of DNA, RNA, or cDNA can be facilitated
through the use of nucleic acid amplification methods. Such methods
specifically increase the concentration of polynucleotides that span the
polymorphic site, or include that site and sequences located either
distal or proximal to it. Such amplified molecules can be readily
detected by gel electrophoresis, fluorescence detection methods, or other
means. Thus, amplification assays, the oligonucleotides used in such
assays, and the corresponding nucleic acid products produced by such
assays can also be used in a marker-assisted breeding program to select
for progeny having the desired trait or traits by selective breeding.
[0107] Likewise, MAS based upon resistance to ACCase-inhibtor herbicides
can be done on a purely phenotypic basis. Initially plants are bred and
selected, or engineered, such that a trait of interest is in non-random
associate (linkage) with an allele conferring
ACCase-inhibitor-resistance. Then that plant can be crossed with a plant
having other desirable trait(s). Plants displaying resistance to ACCase
inhibitors will be presumed to also carry the trait that is linked to the
resistance marker. The presumption will be stronger as the linkage is
closer/higher. Thus, an ACCase-inhibitor-resistance allele can serve
either as a phenotypic marker for MAS, by producing plants that, for
example, survive an otherwise lethal dose of an ACCase inhibitor, or as a
molecular marker due to the ease of detection of the sequence variant
associated with the resistance allele. For example, herbicide resistance,
which is associated with an ACCase sequence variance, can be assayed. The
herbicide resistance trait can include resistance to any one or more
herbicides selected from the group of: alloxydim, butroxydim,
cloproxydim, profoxydim, sethoxydim, clefoxydim, clethodim, cycloxydim,
tepraloxydim, tralkoxydim, chloraizfop, clodinafop, clofop, cyhalofop,
diclofop, fenoxaprop, fenthiaprop, fluazafop-butyl, fluazifop, haloxyfop,
isoxapyrifop, metamifop, propaquizafop, quizalofop, trifop and pinoxaden.
Selection by application of an ACCase inhibtor herbicide and observance
of resistance to the herbicide can be evaluated as herein described.
[0108] MAS protocols are well known in the art, and employ various markers
as tools. For example, MAS is described in U.S. Pat. No. 5,437,697, U.S.
Patent Publication No. 2005/000204780, U.S. Patent Publication No.
2005/000216545, U.S. Patent Publication No. 2005/000218305, U.S. Patent
Publication no. 2006000504538, U.S. Pat. No. 6,100,030 and in Mackill
(2008. Phil Trans R Soc B 363:557-572), each of the foregoing which is
incorporated herein by reference in its entirety. Accordingly, a person
of skill in the art can use the resistance phenotype or sequences of the
invention as a tool in an MAS protocol to select for traits that are
linked to an ACCase-inhibitor-resistance allele.
[0109] Having described the invention in detail, it will be apparent that
modifications, variations, and equivalent embodiments are possible
without departing the scope of the invention defined in the appended
claims. Furthermore, it should be appreciated that all examples in the
present disclosure are provided as non-limiting examples.
EXAMPLES
[0110] The following non-limiting examples are provided to further
illustrate embodiments of the invention disclosed herein. It should be
appreciated by those of skill in the art that the techniques disclosed in
the examples that follow represent approaches that have been found to
function well in the practice of embodiments of the invention, and thus
can be considered to constitute examples of modes for its practice.
However, those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the specific
embodiments that are disclosed and still obtain a like or similar result
without departing from the spirit and scope of the invention.
Example 1
Callus Production Obtained from Intercalary Meristem of a Plant
[0111] An exemplary explant selection is illustrated in FIG. 18. Explant
tissue can be obtained from a shoot containing the uppermost three
leaves. The shoot is cut below the lowest leaf node, and the top of each
leaf can be trimmed to conserve space during the sterilization procedure.
The sections are placed in a bleach solution (20% v/v), for approximately
10 minutes, followed by 10 minutes in 70% ethanol before being rinsed
with sterile water. The outer (older) two leaves are removed, leaving the
newest leaf on the stem remaining. The new leaf is sterilized in 20%
bleach for 1 minute, 70% ethanol for 1 minute, and subsequently rinsed in
sterile water. The base of the leaf, next to the node, is the intercalary
meristem. The lower 5 mm of this section is removed and plated on callus
induction medium containing MS basal salts (Murashige and Skoog. 1962.
Physiol Plant 15:473-497, which is incorporated herein by reference in
its entirety) supplemented with B5 vitamins (Gamborg et al. 1968. Exp
Cell Res 50:151-158, which is incorporated herein by reference in its
entirety), 2,4-dichlorophenoxyacetic acid ("2,4-D"), sucrose, and
adjusted to a pH of 8.5. The plated explants are placed in the dark at a
temperature of 27.degree. C.
TABLE-US-00006
TABLE 1
Callus induction medium
Component Concentration (per liter of medium)
MS basal salts (Murashige and Skoog. 1962. supra)
B5 vitamins (Gamborg et al. 1968. supra)
2,4-D 2 mg
Sucrose 30 g
Gelzan .RTM. 2 g
Example 2
Callus Production Obtained from Immature Inflorescences of Paspalum
[0112] Immature inflorescences were harvested from greenhouse grown plants
prior to emergence and used as a source of explant tissue for generation
of callus. The two spikes were separated and surface sterilized with 10%
(v/v) bleach with several drops of Tween 80 for 10 minutes and rinsed
with sterile water prior to plating on MS medium with B5 vitamins
(Murashige and Skoog. 1962. supra; Gamborg et al. 1968. supra) and 2 mg/L
2-4,D. Explant tissue from 10 genotypes was obtained, including eight
experimental lines from the University of Georgia Seashore Paspalum
Breeding Program, one collected ecotype (Mauna Kea (PI 647892)), and the
commercial seeded variety `Seaspray`. Four explants were placed on each
plate, and the plates were sealed with Nescofilm.TM. (Karlan Research
Products Co; Cottonwood, Ariz.). The explants were placed in the dark at
27.degree. C. A total of 21 cell lines were generated from these 10
genotypes between (Table 2). Each generated callus was given a cell line
designation based on the genotype and the date the explant tissue was
placed on induction medium.
TABLE-US-00007
TABLE 2
Summary of in vitro callus generation and selection for mutations
conferring sethoxydim resistance in seashore paspalum
Calli SR Positive
Cell Cell Line Through SR Regen- for 1781
Line Genotype Initiation Selection Calli erating Mutation
1 Mauna Kea 28 Nov 07 225 0 0 0
2 Mauna Kea 5 Dec 07 1350 3 0 0
3 Mauna Kea 12 Dec 07 225 0 0 0
4 Mauna Kea 9 Jan 08 1125 0 0 0
5 Mauna Kea 12 Jan 08 2025 29 2 2
6 Mauna Kea 21 Jan 08 450 7 0 0
7 Mauna Kea 6 Mar 08 1350 2 0 0
8 Mauna Kea 20 Mar 08 675 0 0 0
9 Seaspray 12 Jan 08 225 0 0 0
10 03-527.8 8 Jan 08 1575 0 0 0
11 03-527.8 21 Jan 08 900 0 0 0
12 03-527.8 16 May 08 225 0 0 0
13 03.539.13 6 Mar 08 3825 11 0 0
14 03.539.13 13 Mar 08 1800 7 0 0
15 05-025-164 20 Mar 08 675 0 0 0
16 05-025-164 9 Apr 08 450 2 0 0
17 05-025-181 4 Mar 08 450 1 0 1
18 03-107C-1 4 Mar 08 450 0 0 0
19 03-098E-3 4 Mar 08 900 2 1 0
20 03-134F.17 4 Mar 08 225 0 0 0
21 03.525.22 20 Apr 08 1125 1 0 0
Total 20250 65 3 3
Example 3 Dose-Response Curve of Paspalum to Herbicide
[0113] The dose response of paspalum tissue in culture to sethoxydim rate
was determined using callus tissue generated from the variety `Seaspray`
as a model cultivar. Effect of sethoxydim concentration on callus growth
was determined by placing callus tissue from `Seaspray` on MS/B5 medium
(Murashige and Skoog. 1962. supra; Gamborg et al. 1968. supra) containing
2 mg/L 2-4,D and one of eight concentrations of sethoxydim. Herbicide
rates were replicated 6 times and included concentrations of 0, 2.5, 5,
7.5, 10, 25, 50, and 100 .mu.M sethoxydim. Sethoxydim was diluted in
methanol and added after the autoclaved medium was cooled to
approximately 55.degree. C. (in order to prevent loss of activity from
heat degradation). The medium was protected from photo-degradation by
wrapping containers in aluminum foil prior to storage.
[0114] To measure callus growth, 0.5 gram of callus tissue was weighed,
separated into nine equal pieces and placed in a 3.times.3 pattern on the
solid medium of each plate. Six replicate plates for each of the eight
sethoxydim concentrations was distributed on a rack in a growth room in a
completely randomized design. At 21 days after plating, the tissue from
each plate was weighed and recorded. For subculture, 0.5 gram from each
plate was obtained for the next growth period. This process was continued
for nine weeks, providing three growth measurements for each plate. The
weight from each plate at each measurement point (3 weeks, 6 weeks, and 9
weeks) was divided by the initial weight to obtain the comparative
increase in mass. Callus growth for each herbicide rate averaged over the
three consecutive subcultures was used to discern an appropriate
concentration for selection of mutants. Callus growth in response to
sethoxydim concentration was fitted to a negative exponential decay
function using non-linear regression (SAS Institute, Inc. 2008. SAS
OnlineDoc.RTM. 9.2. Cary, N.C.). The lowest herbicide rate to totally
inhibit callus growth was 7.5 .mu.M sethoxydim. To ensure efficacy, a
concentration of 10 .mu.M sethoxydim was chosen for selection of
resistant cells (FIG. 3).
Example 4
Selection of Sethoxydim-Resistant Cell Lines
[0115] Selection of sethoxydim resistant (SR) cells was performed by
placing approximately six-month old callus tissue on callus induction
medium (Example 1) containing 10 .mu.M sethoxydim. Large plates
(245.times.245 mm in size) were used to efficiently screen greater
numbers of cells. Callus tissue approximately 4-mm in diameter was placed
in a 15.times.15 grid, giving a total of 225 calli per plate. Calli were
subcultured three times at three-week intervals (Example 3) for a total
selection period of nine weeks. Resistant calli were subcultured into
100.times.15 mm petri dishes containing callus induction medium (Example
1) supplemented with 10 .mu.M sethoxydim for one month in order to obtain
sufficient callus. This provided a total selection time of 12 weeks or
more.
[0116] A total of 20,250 calli were screened. The selection process
resulted in 65 sethoxydim-resistant (SR) lines, representing a mutation
rate of one resistance event per 312 calli. The six cell lines that
produced SR calli were: Mauna Kea, GA 05-025-164, UGA03.539.13,
UGA05.025.181, UGA03.525.22, and UGA03.09E-3. The frequency of SR calli
was low in all genotypes and ranged from 0 to 0.0051. Even though the
probability of recovering a SR line was low for all genotypes, the number
of SR lines recovered varied and ranged from zero to as high as nine per
plate of 225 calli. Statistical analysis for differences in the
probability of obtaining a resistant calli event indicated no significant
differences (p=0.35) among genotypes. Resistant calli were given SR
designations, removed from selection medium, and subcultured to increase
tissue prior to regeneration.
Example 5
Regeneration of Sethoxydim Resistant Lines
[0117] Regeneration was attempted on all resistant calli. The regeneration
medium used was MS/B5 medium (Murashige and Skoog. 1962. supra; Gamborg
et al. 1968. supra) supplemented with 1.24 mg/L CuSO.sub.4, and 1.125
mg/L 6-benzylaminopurine (BAP) (Altpeter, et al. 2005. International
Turfgrass Society Research Journal 10:485-489, which is incorporated
herein by reference in its entirety). Calli of each sethoxydim resistant
(SR) line were placed in a 4.times.4 grid on five plates, with each
callus having an approximate diameter of 4 mm in size. The plates were
then placed in a growth chamber at 25.degree. C. with a 1-h dark:23-h
light photoperiod, wherein the light intensity was provided at 66-95
.mu.mol photons m.sup.-2s.sup.-1 by cool white fluorescent tubes. All
plates were evaluated for regeneration at the end of a 30-day period. If
shoots appeared the cell lines were subcultured for an additional month
on regeneration medium.
[0118] After shoot development, roots were induced by placing tissue on
MSO medium (as listed in Table 3 below) without growth regulators. When
root growth was adequate (about 30 days), plants were removed from the
medium and placed directly in pots containing a 1:1 mix of Fafard.RTM. 3B
(Agawam, MS) mix and sand. The potted plants were then transferred to a
greenhouse with 10 hour light, 14 hour dark photoperiods at 24.degree. C.
to 32.degree. C.
TABLE-US-00008
TABLE 3
MSO medium for root induction
Component Concentration (per liter of medium)
MS basal salts (Murashige and Skoog. 1962. supra)
B5 vitamins (Gamborg et al. 1968. supra)
Sucrose 30 g
Gelrite .RTM. 2 g
[0119] Two of the 65 SR cell lines were lost prior to regeneration, thus,
of the 63 SR lines remaining, three lines were regenerated: Line A, Line
B, and Line C. Lines A and B originated from the same cell line derived
from Mauna Kea initiated on 12 Jan. 2008, while Line C originated from
experimental line UGA 03-098E-3 initiated on 4 Mar. 2008. The callus
tissue of the three lines that regenerated was dense and yellow compared
to a majority of the lines, which were white and soft.
Example 6
Molecular Characterization of Sethoxydim Resistant Lines
[0120] Once SR paspalum lines were selected, the mutation causing the
resistance was characterized. DNA was extracted from the callus or leaf
tissue of regenerated plants using the CTAB method (Lassner et al. 1989.
Plant Mol Biol Report 7:116-128, which is incorporated herein by
reference in its entirety). Acetyl coenzyme A carboxylase (ACCase) amino
acid sequences (Delye, et al. 2005. Weed Research 45:323-330, which is
incorporated herein by reference in its entirety) were used to determine
homologous regions among species. The nucleotide sequence from Setaria
viridis ACCase (GenBank AF294805) (Delye, et al. 2002. Planta
214:421-427, which is incorporated herein by reference in its entirety)
was used to design primers that amplify the homologous region in seashore
paspalum, and individual bases were changed to match the highest number
of grass species possible as determined by the BLAST function of GenBank.
The resulting primers amplify a 384 base pair fragment of the ACCase gene
that spans the A to T transversion which causes the Ile to Leu
substitution at the 1781 position. The primers were designated SV384F (5'
CGGGGTTCAGTACATTTAT 3', SEQ ID NO: 1) and SV348R (5'
GATCTTAGGACCACCCAACTG 3', SEQ ID NO: 2). The annealing temperature was
53.degree. C. with an extension time of 30 seconds and 35 cycles. The
primers developed for sequencing the 2078 position of the ACCase gene
were designated SVAC2F (5' AATTCCTGTTGGTGTCATAGCTGTGGAG 3', SEQ ID NO: 3)
and SVAC1R (5' TTCAGATTTATCAACTCTGGGTCAAGCC 3', SEQ ID NO: 4), and the
PCR conditions used to amplify this segment were the same as the
conditions to used to amplify 1781. The SVAC primers amplify a 520-bp
fragment that spans the coding region of position 2078 in the ACCase
gene.
Example 7
Identification of Sethoxydim Resistant Cell Lines and Regeneration of
Sethoxydim Resistant Paspalum from Cell Lines
[0121] Table 2 summarizes the selection process to date. To date, 65
sethoxydim resistant cell lines have been produced. The frequency of
resistant calli formation was 1 per 312 calli undergoing the full
selection process. The frequency of regenerable sethoxydim resistant (SR)
calli was 1 per 32.5 resistant calli. The frequency of SR lines that
regenerated was 1 per 10,125 calli put through the selection process.
[0122] The average volume of a single callus cell was measured to be
1.3582.times.10.sup.-5 .mu.L. This provides an approximation of 258,000
cells per 4 mm-diameter callus piece. Thus, the 20,250 calli put through
selection contained approximately 5.2 billion cells. Assuming that only a
single mutant cell was responsible for each SR cell line, the frequency
of resistant cells in this experiment was one per 8.times.10.sup.7 cells.
The frequency of obtaining the A to T mutation at the 1781 aa position
was one in 1.74.times.10.sup.9.
[0123] To date, four SR calli, Line A, Line B, Line C and Line D have
produced green plantlets, and two SR calli (Line A and Line B) have been
established as viable plants. Lines A, B and D originated from the same
cell line, Mauna Kea 12Jan. 2008, while Line C originated from
experimental line UGA 03-098E-3 initiated on 4 Mar. 2008. Line A has been
the most prolific in terms of regenerated plants, producing more than 500
individual plants. Line B has produced approximately 20 plants.
[0124] ACCase amplicons were obtained from 63 of the 65 SR lines, and only
three lines, including Line A (FIG. 5), exhibited the A to T transversion
at position 1781. The possibility exists that mutations at positions
other than 1781 or 2078 also occurred in these SR cell lines. Resistant
lines are heterozygous for the mutation, so the sequence chromatograms
illustrate a double peak at the point of mutation, with one peak
representing the wild-type allele, and the other the mutated allele. Of
the two lines that produced viable plants, only Line A possesses the
expected Ile to Leu mutation. The genetic sequence of the amplicon
obtained for Line A is given below as SEQ ID NO: 5, with the highlighted
and underlined codon indicating the Ile to Leu mutation. Line B has the
wild-type sequence at position 1781. Since sethoxydim resistance can also
be conferred by an Asp to Gly mutation at the 2078 position; DNA from
Line B was analyzed for presence of this mutation, but neither line
possessed it. The nature of sethoxydim resistance remains undetermined
for Line B.
[0125] More that 500 Line A plants have been transplanted to soil. The
regenerated plants of Line A were vegetatively increased for undergoing
herbicide testing in order to confirm expression of sethoxydim resistance
at the whole plant level.
TABLE-US-00009
SEQ ID NO: 5
GGCGATTGGGCCGAAGTCGCATGCTCCCGGCCGCCATGGCGGCCGCGGGA
ATTCGATACCCCTTTTTCAGTACATTTATCTGACTGAAGAAGATTATGCT
CGTATTAGCTCTTCTGTTATAGCACATAAGCTACAGCTGGACAGCGGTGA
AATTAGGTGGATTATTGACTCTGTTGTGGGCAAGGAGGATGGGCTTGGTG
TTGAGAATTTACATGGAAGTGCTGCTATTGCCAGTGCTTATTCTAGGGCA
TACGAGGAGACATTTACACTTACGTTCGTGACTGGGCGGACTGTAGGAAT
AGGAGCTTATCTTGCACGACTTGGTATACGGTGCATACAGCGTCTTGACC
AGCCCATTATTTTAACAGGGTTTTCTGCCCTGAACAAGCTTCTTGGGCGT
GAAGTTTACAGCTCCCACATGCAGTTGGGTGGTCCTAAGATCATGGCGAC
GAATGGTGTTGTCCACCTCACTGTTTCAGATGATCTTGAAGGTGTATCCA
GTATATTGAGGTGGCTCAGCTATGTTCCTGCCAACATTGGTGGACCTCTT
CCTATTACAAAACCTTTGGACCCACCGGACAGACCTGTTGCGTACATCCC
TGAGAACACATGCGATCCACGTGCAGCCATCCGTGGTGTAGATGACAGCC
AAGGGCAATGGTTGGGTGGTATGTTTGACAAAGACAGCTTTGTGGAGACA
TTTGAAGGATGGGCGAAAACAGTTGTCACTGGCAGGGCATAGCTTGGAGG
AATTCCTGTGGGTGTCATAGCTGTGGAGACACAGAACATGATGCAGCTCA
TCCCTGCTGATCCAGGCCAGCTTGATTCTCATGAGCGATCTGTTCCTCGG
GCTGAACAAGTGTGGTTCCCAGATTCTGCAACCAAGACTGCTCAAGCATT
GTTGGACTTCAACCGTGAAGGATTGCCTCTGTTCATCCTTGCTAACTGGA
GAGGTTTCTCTGGTGGACAAAGAGATCTCTTTGAAGGAATTCTTCAGGCT
GGGTCAACAATTGTTGAGAACCTTAGGACGTACAATCAACCTGCGTTTGT
CTACATTCCTATGGCTGGAGAGCTGCGTGGAGGAGCTTGGGTTGTGGTTG
ATAGCAAAATAA
[0126] A vector containing SEQ ID NO: 5 was deposited with the American
Type Culture Collection, 10801 University Boulevard, Manassas, Va.
20110-2209 U.S.A. on Jun. ______, 2009 and assigned Accession No. ______.
Example 8
Evaluation of Whole Plant Resistance to Sethoxydim (Segment.TM. Herbicide)
[0127] Sethoxydim-resistant plants regenerated from a sethoxydim-resistant
cell line, Line A, were tested for resistance at the whole plant level in
a dose-response experiment conducted in a greenhouse. In this experiment,
Line A was compared to two herbicide-susceptible controls; the original
parent line, Mauna Kea (PT); and a Mauna Kea line regenerated from tissue
culture (TTC). Plants were transplanted to Cone-tainers.TM. measuring
4.times.14 cm and tapering to 1 cm (Stuewe and Sons Inc., Corvallis,
Oreg.) containing a 1:1 mix of Fafard.RTM. 3B mix and sand and placed on
benches under sodium lights in a greenhouse with a 16 hour photoperiod
maintained at 27/32.degree. C. day/night for two weeks prior to treatment
applications. Each of the three genotypes, Line A, PT and TC were treated
with 0, 50, 100, 200, 400, 800, 1600, and 3200 g ai ha.sup.-1 rates of
sethoxydim using Segment.TM. herbicide (BASF Corp., Florham Park, N.J.).
All herbicide rates were applied at a spray volume of 1871 ha.sup.-1 in
an experimental spray chamber, and after drying, returned to the
greenhouse bench and maintained under the conditions described above.
Visual estimates of crop injury were recorded at 7, 14, 21, and 28 days
after treatment (DAT) using a scale of 0 to 100, where 0 equals no injury
and 100 equals complete death. At 42 days after treatment, the above
ground portion of all plants was harvested, dried for 48 hours at a
temperature of 50.degree. C., and weighed to determine plant dry weight.
Treatments were arranged in a randomized complete block design. Only two
replications of TCC were possible due to limited plant materials;
otherwise four replications were used for the other two genotypes (PT and
Line A). Data were first analyzed using a two-way analysis of variance
and subsequently analyzed within herbicide rate. Differences among
genotype means at each herbicide rate were determined using Fisher's
Least Significant Difference (LSD).
[0128] FIG. 9 illustrates the effect of sethoxydim rate on injury ratings
of each of the three tested genotypes at 14 DAT. FIG. 11 illustrates the
effect of sethoxydim rate on injury ratings of each of the three tested
genotypes at 21 DAT. The two-way analysis of variance indicated
significant genotype, herbicide rate, and genotype by herbicide rate
effects for injury ratings at 7, 14, 21, and 28 days after treatment
(data not shown). Line A showed excellent herbicide resistance, even at
the highest rate of 3200 g ai ha.sup.-1 (FIG. 8, Table 4). In contrast,
both PT and TC had injury scores of 30 or greater at rates of 200 g ai
ha.sup.-1, and injury scores of 80% or greater at rates equal to or
greater than 800 g ai ha.sup.-1. When mean injury scores were compared
for each of the three genotypes at each herbicide rate, Line A had
significantly less injury than PT or TC at all rates above 100 g ai
ha.sup.-1 at all rating dates. The maximum injury score observed on Line
A was 7.5% at 3200 g ai ha.sup.-1, or 15 times greater dosage than the
lowest labeled rate for centipedegrass, Eremochloa ophiuroides (Munro)
Hack, a turfgrass species naturally tolerant to sethoxydim.
[0129] Mean dry weight of the three genotypes taken 42 DAT are presented
in FIG. 12. Dry weights of the two susceptible lines, PT and TCC
decreased in response to increasing sethoxydim rate while the dry weight
of CLA remained relatively unchanged even at rates above 1600 g ai
ha.sup.-1.
[0130] Estimates of LD.sub.50 for the three genotypes were 189, 276, and
>3200 g ai ha.sup.-1 for PT, TC, and Line A, respectively. These data
provide evidence that the level of herbicide resistance present in Line A
is more than adequate to provide effective control of susceptible weedy
grasses without concerns over herbicide injury.
TABLE-US-00010
TABLE 4
Response of three genotypes of seashore paspalum to sethoxydim rate.
Plant Injury Dry Weight
Herbicide 7 DAT.sup.2 14 DAT 21 DAT 28 DAT 42 DAT
Rate.sup.1 PT TC Line A PT TC Line A PT TC Line A PT TC Line A PT TC Line
A
grams % grams
0 0.0a.sup.3 0.0a 1.7a 0.0a 5.0a 2.5a 0.0a 2.5a 2.5a 0.0a 0.0a 0.0a 2.1a
2.5a 1.9a
50 5.2a 4.5a 2.9a 6.2b 12.5ab 0.0b 5.0a 2.5a 1.2a 1.2a 0.0a 0.0a 1.6a 2.2a
1.7a
100 7.9b 18.3b 0.8a 22.5b 25.0b 1.2a 13.8a 20.0a 3.8a 6.2a 7.5a 2.5a 1.3b
1.6ab 2.0a
200 20.8b 16.7b 1.7a 55.0b 30.0b 0.0a 52.5b 40.0b 0.0a 43.8b 32.5b 0.0a
0.8b 0.4b 1.9a
400 30.8b 30.8b 3.8a 67.5b 82.5b 0.0a 67.5b 80.0b 2.5a 72.5b 82.5b 0.0a
0.2b 0.1b 2.0a
800 35.0b 60.0c 1.2a 85.0b 87.5b 1.2a 85.0b 95.0b 3.8a 88.8b 100.0c 1.2a
0.3b 0.1b 2.0a
1600 40.8b 43.3b 4.3a 90.0b 100.0c 0.0a 92.5b 100.0c 3.8a 92.5b 100.0b
1.2a 0.2b 0.1b 1.5a
3200 37.9b 46.7b 8.3a 100.0b 100.0b 7.5a 100.0b 100.0b 5.5a 100.0b 100.0b
4.2b 0.1b 0.1b 1.6a
.sup.1Grams a.i. ha.sup.-1
.sup.2DAT = days after treatment.
.sup.3Means on the same row (herbicide rate) and within a measured
variable group (i.e. 7 DAT) followed by the same letter are not
considered to be significantly different at 0.05 according to a protected
LSD.
Example 9
Evaluation of Whole Plant Resistance to Sethoxydim (Poast.TM. Herbicide)
[0131] A second greenhouse experiment was initiated to evaluate SR plants
regenerated from a second sethoxydim-resistant cell line, Line B, for
sethoxydim resistance at the whole plant level. In the previous
experiment (Example 8), minor injury occurred on Line A at higher
concentrations of Segment.TM. sethoxydim herbicide. These injury symptoms
were more indicative of surfactant injury rather than sethoxydim injury.
Accordingly, Poast.TM. herbicide, a formulation of sethoxydim that does
not contain surfactant, was chosen to characterize the resistance level
of Line B and to compare the level of sethoxydim resistance of Line B to
Line A. In this experiment both Line A and Line B were compared to two
herbicide-susceptible controls: the original parental line, Mauna Kea
(PT); and a Mauna Kea line regenerated from tissue culture (TTC). Plants
were transplanted to Cone-tainers.TM. measuring 4.times.14 cm and
tapering to 1 cm (Stuewe and Sons Inc., Corvallis, Oreg.) containing a
1:1 mix of Fafard.RTM. 3B mix and sand and placed on benches under sodium
lights in a greenhouse with a 16-h photoperiod maintained at
27/32.degree. C. day/night for approximately two weeks prior to
application of herbicide treatments.
[0132] Each of the four genotypes (Line A, Line B, PT and TCC) were
treated with 0, 50, 100, 200, 400, 800, 1600, 3200 and 6400 g ai
ha.sup.-1 rates of sethoxydim using Poast.TM. herbicide (BASF Corp.,
Florham Park, N.J.). All herbicide rates were applied at a spray volume
of 1871 ha.sup.-1 in an experimental spray chamber, and after drying, the
plants were returned to the greenhouse bench and maintained under the
conditions described above. Visual estimates of crop injury were recorded
at 16, 21, and 28 d after treatment (DAT) using a scale of 0 to 100,
where 0 equals no injury and 100 equals complete death. The experiment
was a four by nine factorial with four genotypes and nine herbicide
rates. Treatments were arranged in a randomized complete block design.
Four replications were used for all four genotypes. Data were first
analyzed using a two-way analysis of variance (SAS, 2008) and
subsequently analyzed within herbicide rate. Differences among genotype
means at each herbicide rate were determined using Fisher's Least
Significant Difference (LSD).
[0133] FIG. 13 illustrates the effect of sethoxydim rate on injury ratings
of each of the four tested genotypes at 21 DAT. The two-way analysis of
variance indicated significant genotype, herbicide rate, and genotype by
herbicide rate effects for injury ratings at 16, 21, and 28 DAT (data not
shown). Both Line A and Line B showed excellent herbicide resistance,
even at the highest rate of 6400 g ai ha.sup.-1 (FIG. 13). In contrast,
both PT and TCC. had injury scores of 27 or greater at rates of 400 g ai
ha.sup.-1, and injury scores of 80% or greater at rates of 1600 g ai
ha.sup.-1 or more. When mean injury scores were compared for each of the
four genotypes at each herbicide rate, Line A and Line B had
significantly less injury than PT or TCC at all rates of above 200 g ai
ha.sup.-1 at all rating dates. The maximum injury score observed on Line
A and Line B was less than 20% for all rates up to 6400 g ai ha.sup.-1.
[0134] Estimates of LD.sub.50 for the four genotypes were 720, 782,
>6400, >6400 g ai ha.sup.-1 for PT, TC, Line A, and Line B,
respectively. These data provide strong evidence that the level of
herbicide resistance present in both Line A and Line B is more than
adequate to provide effective control of susceptible weedy grasses
without concerns over herbicide injury.
Example 10
Cross-Resistance of Sethoxydim-Resistant Paspalum to Other ACCase
Inhibitor Herbicides
[0135] Sethoxydim is a member of the class known as ACCase inhibiting
herbicides. This family of herbicides is often divided into two groups,
the cyclohexanediones (CHD), characterized by a cyclohexane ring, and
commonly referred to as the "Dims", and the aryloxyphenoxypropionate
(APP) herbicides, commonly referred to as the "Fops". Depending on
structural and/or side chain similarities, resistance to sethoxydim can
be indicative of resistance to a broad class of herbicides in the ACCase
inhibitor family. For example, cross resistance to both CHD and APP
herbicides has been reported in several weedy species of plants
possessing the 1781 ILE to LEU mutation most commonly associated with
sethoxydim resistance (Delye, 2005. Weed Science 53:728-746, which is
incorporated herein by reference in its entirety). Accordingly,
resistance of sethoxydim-resistant Lines A and B to other ACCase
inhibiting herbicides was determined in a series of greenhouse
experiments
[0136] In the experiments, both Line A and Line B were compared to two
herbicide-susceptible controls; the original parental line, Mauna Kea
(PT); and a Mauna Kea line regenerated from tissue culture (TTC). Plants
were transplanted to Cone-tainers.TM. measuring 4.times.14 cm and
tapering to 1 cm (Stuewe and Sons Inc., Corvallis, Oreg.) containing a
1:1 mix of Fafard.RTM. 3B mix and sand and placed on benches under sodium
lights in a greenhouse with a 16-h photoperiod maintained at
27/32.degree. C. day/night for approximately two weeks prior to
application of herbicide treatments.
[0137] Each of the four genotypes, Line A, Line B, PT, TCC, were compared
in three separate herbicide dose-response experiments. Herbicides tested
included fluazifop-p-butyl (Fusilade II.TM.) and fenoxaprop-p-ethyl
(Acclaim Extra.TM.). In the each of the experiments four replicates of
each of the four genotypes was treated with nine rates of the appropriate
herbicide. The fluazifop rates 0, 25, 50, 100, 200, 400, 800, 1600 and
3200 g ai ha.sup.-1 rates of fluazifop-p-butyl using Fusilade II.TM.
herbicide (Syngenta Crop Protection, Inc., Greensboro, N.C.). The
fenoxaprop rates were 0, 25, 50, 100, 200, 400, 800, 1600 and 3200 g ai
ha.sup.-1 rates of fenoxaprop-p-ethyl using Acclaim Extra.TM. herbicide
(Bayer Environmental Science, Montvale, N.J.). All herbicide rates were
applied at a spray volume of 187 L ha.sup.-1 in an experimental spray
chamber, and after drying, the plants were returned to the greenhouse
bench and maintained under the conditions described above. Visual
estimates of crop injury were recorded at 21 and 28 days after treatment
(DAT) using a scale of 0 to 100, where 0 equals no injury and 100 equals
complete death. The experiment was a four by nine factorial with four
genotypes and nine herbicide rates. Treatments were arranged in a
randomized complete block design. Four replications were used for all
four genotypes. Data were first analyzed using a two-way analysis of
variance (SAS, 2008) and subsequently analyzed within herbicide rate.
Differences among genotype means at each herbicide rate were determined
using Fisher's Least Significant Difference (LSD).
[0138] FIG. 14 illustrates the effect of fluazifop rate on injury ratings
of each of the four tested genotypes at 21 DAT. The two-way analysis of
variance indicated significant genotype, herbicide rate, and genotype by
herbicide rate effects for injury ratings at 21, and 28 DAT (data not
shown). Both Line A and Line B showed significantly less injury than PT
and TCC at all rates above 50 g ai ha.sup.-1. Estimates of LD.sub.50 for
the four genotypes were 36, 37, 800, and 516 g ai ha.sup.-1 for PT, TC,
Line A, and Line B, respectively. These data provide strong evidence of
the presence of cross resistance to fluazifop in both Line A and Line B.
The level of cross resistance present is adequate to provide effective
control of susceptible weedy grasses without serious concerns over
herbicide injury.
[0139] FIG. 15 illustrates the effect of fenoxaprop rate on injury ratings
of each of the four tested genotypes at 21 DAT. The two-way analysis of
variance indicated significant genotype, herbicide rate, and genotype by
herbicide rate effects for injury ratings at 21, and 28 DAT (data not
shown). Both Line A and Line B showed significantly less injury than PT
and TCC at all rates above 50 g ai ha.sup.-1. In this experiment both
Line A and Line B expressed very high levels of cross resistance to
fenoxaprop. Line A was injured less than 20% at all fenoxaprop rates up
1600 g ai ha.sup.-1 and Line B was injured less than 20% even at the
highest rate of 3200 g ai ha.sup.-1. Estimates of LD.sub.50 for the four
genotypes were 56, 22, >3200, and >3200 g ai ha.sup.-1 for PT, TC,
Line A, and Line B, respectively. These data provide strong evidence of
the presence of cross resistance to fenoxaprop in both Line A and Line B.
The level of cross resistance present is more than adequate to provide
effective control of susceptible weedy grasses without serious concerns
over herbicide injury.
Example 11
Selection of Sethoxydim-Resistant Cell Lines in Bent Grass
[0140] To induce callus tissue formation, seeds of bent grass are
surface-sterilized in 10% bleach for four hours while being vigorously
shaken. The sterilized seeds are then placed on callus induction medium
as described in Table 5 (Luo, et al. 2003. Plant Cell Reports
22(9):645-652, which is incorporated herein by reference in its
entirety).
TABLE-US-00011
TABLE 5
Callus induction medium for bent grass
Component Concentration (per liter of medium)
MS/B5 medium (Murashige and Skoog. 1962. supra; Gamborg
et al. 1968. supra)
Dicamba 6.6 mg
Casein hydrolysate 500 mg
Sucrose 30 g
Gelrite .RTM. 2 g
[0141] Once callus tissue from bent grass is obtained, the calli are
screened by the sethoxydim selection process as previously described
(Example 4). Briefly, selection of sethoxydim resistant (SR) cells is
performed by placing callus tissue on callus induction medium (Table 5)
containing 10 .mu.M sethoxydim. Large plates (245.times.245 mm in size)
are used to efficiently screen greater numbers of cells. Callus tissue
approximately 4-mm in diameter are placed in a 15.times.15 grid, giving a
total of 225 calli per plate. Calli are subcultured three times at
three-week intervals (Example 3) for a total selection period of nine
weeks. Resistant calli are subcultured into 100.times.15 mm petri dishes
containing callus induction medium (Table 5) supplemented with 10 .mu.M
sethoxydim for one month in order to obtain sufficient callus. This
provided a total selection time of 12 weeks or more.
Example 12
Regeneration of Sethoxydim-Resistant Cell Lines in Bent Grass
[0142] Once sethoxydim-resistant calli are obtained, regeneration is
attempted on all resistant calli. The regeneration medium used as as
described in Table 6 (Luo, et al. 2003. supra).
TABLE-US-00012
TABLE 6
Regeneration medium for bent grass
Component Concentration (per liter of medium)
MS/B5 medium (Murashige and Skoog. 1962. supra;
Gamborg et al. 1968. supra)
Myo-inositol 100 mg
6-benzylaminopurine (BAP) 1 mg
Sucrose 30 g
Gelrite .RTM. 2 g
[0143] Any regeneration protocol known to those of skill in the art can be
conducted for regeneration of sethoxydim-resistant bent grass calli. An
exemplary regeneration protocol is described in Luo, et al. (2003.
supra), Another exemplary regeneration protocol is described in Example
5.
Example 13
Molecular Characterization of Sethoxydim Resistant Lines in Bent Grass
[0144] Once sethoxydim-resistant (SR) bent grass lines are identified, the
mutation causing the resistance can be characterized. An exemplary
protocol to identify a mutation at position 1781 of the ACCase gene is
describe herein (Example 6). In addition, the bent grass lines can be
analyzed for mutations at any other positions in the ACCase gene by
designing primers to amplify specific regions that include positions
2027, 2041, 2078 (Example 6) and 2096 (Delye. 2005. supra). Designing
primers and amplifying regions for sequence analysis is well known to
those of skill in the art.
Example 14
Evaluation of Whole Plant Resistance to Sethoxydim and ACCase Inhibitors
Herbicides in Bent Grass
[0145] Once sethoxydim-resistant bent grass plants are regenerated, whole
plant resistance to sethoxydim can be conducted as herein described
(Examples 8 and 9). In addition, cross-resistance to other ACCase
inhibitor herbicides can be carried out as herein described (Example 10),
Example 15
Induction of Callus Tissue from Tall Fescue Grass
[0146] To induce callus tissue formation, seeds of tall fescue grass are
sterilized in 50% sulfuric acid for 30 minutes, rinsed with deionized
water and 95% ethanol, and stirred in 100% bleach with 0.1% tween for 30
minutes. The seeds are then rinsed in sterile water 10 times for four
minutes each time. Once sterilized, the seeds are placed on MS/B5D2
medium (Murashige and Skoog. 1962. supra; Gamborg et al. 1968. supra) for
germination. One week later, all germinated seeds are injured by slicing
the seeds to promote callus growth. The sliced seeds are placed in a
callus induction medium as described in Table 7 to induce formation of
callus tissue. The calli are transferred every two weeks for propagation
for use in further experiments.
TABLE-US-00013
TABLE 7
Callus induction medium for tall fescue grass
Component Concentration (per liter of medium)
MS basal salts (Murashige and Skoog. 1962. supra)
B5 vitamins (Gamborg et al. 1968. supra)
Sucrose 30 mg
2,4-D 5 mg
6-benzylaminopurine (BAP) 0.15 mg
Gelzan .TM. 3 g
Example 16 Selection of Sethoxydim-Resistant Cell Lines in Tall Fescue
Grass
[0147] Once callus tissue from tall fescue grass is obtained, the calli
can be screened by the sethoxydim selection process as previously
described (Example 4). Briefly, selection of sethoxydim resistant (SR)
cells is performed by placing callus tissue on callus induction medium
(Table 7) containing 10 .mu.M sethoxydim. Large plates (245.times.245 mm
in size) are used to efficiently screen greater numbers of cells. Callus
tissue approximately 4-mm in diameter is placed in a 15.times.15 grid,
giving a total of between about 200 to 250 calli per plate. Calli are
subcultured three times at two-week intervals (Example 3). Resistant
calli are subcultured into 100.times.15 mm petri dishes containing callus
induction medium (Table 7) supplemented with 10 .mu.M sethoxydim and
propagated for at least one month in order to obtain sufficient callus.
Example 17
Regeneration of Sethoxydim-Resistant Cell Lines in Tall Fescue Grass
[0148] Once sethoxydim-resistant calli are obtained, regeneration is
attempted on all resistant calli. An exemplary regeneration medium as
described in Table 6 (Luo, et al. 2003. supra) can be used. Another
exemplary regeneration protocol is described in Example 5. However, any
regeneration protocol known to those of skill in the art can be conducted
for regeneration of sethoxydim-resistant tall fescue calli.
Example 18
Molecular Characterization of Sethoxydim Resistant Lines in Tall Fescue
Grass
[0149] Once sethoxydim-resistant (SR) tall fescue lines are identified,
the mutation causing the resistance can be characterized. An exemplary
protocol to identify a mutation at position 1781 of the ACCase gene is
describe herein (Example 6). In addition, the tall fescue lines can be
analyzed for mutations at any other positions in the ACCase gene by
designing primers to amplify specific regions that include positions
2027, 2041, 2078 (Example 6) and 2096 (Delye. 2005. supra). Designing
primers and amplifying regions for sequence analysis is well known to
those of skill in the art.
Example 19
Evaluation of Whole Plant Resistance to Sethoxydim and ACCase Inhibitors
Herbicides in Tall Fescue
[0150] Once sethoxydim-resistant tall fescue plants are regenerated, whole
plant resistance to sethoxydim can be conducted as herein described
(Examples 8 and 9). In addition, cross-resistance to other ACCase
inhibitor herbicides can be carried out as herein described (Example 10),
Example 20
Selection of Sethoxydim-Resistant Cell Lines in Zoysiagrass
[0151] To induce callus tissue formation, seeds of zoysiagrass are
sterilized in 50% sulfuric acid for 30 minutes, rinsed with deionized
water and 95% ethanol, and stirred in 100% bleach with 0.1% tween for 30
minutes. The seeds are then rinsed in sterile water 10 times for four
minutes each time. Once sterilized, the seeds are placed on MS/B5D2
medium (Murashige and Skoog. 1962. supra; Gamborg et al. 1968. supra) for
germination. One week later, all germinated seeds are injured by slicing
the seeds to promote callus growth. The sliced seeds are placed in a
callus induction medium as described in Table 7 to induce formation of
callus tissue. The calli are transferred every two weeks for propagation
for use in further experiments.
Example 21
Selection of Sethoxydim-Resistant Cell Lines in Zoysiagrass
[0152] Once callus tissue from zoysiagrass is obtained, the calli can be
screened by the sethoxydim selection process as previously described
(Example 4). Briefly, selection of sethoxydim resistant (SR) cells is
performed by placing callus tissue on callus induction medium (Table 7)
containing 10 .mu.M sethoxydim. Large plates (245.times.245 mm in size)
are used to efficiently screen greater numbers of cells. Callus tissue
approximately 4-mm in diameter is placed in a 15.times.15 grid, giving a
total of between about 200 to 250 calli per plate. Calli are subcultured
three times at two-week intervals (Example 3). Resistant calli are
subcultured into 100.times.15 mm petri dishes containing callus induction
medium (Table 7) supplemented with 10 .mu.M sethoxydim and propagated for
at least one month in order to obtain sufficient callus.
Example 22
Regeneration of Sethoxydim-Resistant Cell Lines in Zoysiagrass
[0153] Once sethoxydim-resistant calli are obtained, regeneration is
attempted on all resistant calli. An exemplary regeneration medium as
described in Table 6 (Luo, et al. 2003. supra) can be used. Another
exemplary regeneration protocol is described in Example 5. However, any
regeneration protocol known to those of skill in the art can be conducted
for regeneration of sethoxydim-resistant zoysiagrass calli.
Example 23
Molecular Characterization of Sethoxydim Resistant Lines in Tall Fescue
Grass
[0154] Once sethoxydim-resistant (SR) tall fescue lines are identified,
the mutation causing the resistance can be characterized. An exemplary
protocol to identify a mutation at position 1781 of the ACCase gene is
describe herein (Example 6). In addition, the tall fescue lines can be
analyzed for mutations at any other positions in the ACCase gene by
designing primers to amplify specific regions that include positions
2027, 2041, 2078 (Example 6) and 2096 (Delye. 2005. supra). Designing
primers and amplifying regions for sequence analysis is well known to
those of skill in the art.
Example 24
Evaluation of Whole Plant Resistance to Sethoxydim and ACCase Inhibitors
Herbicides in Zoysiagrass
[0155] Once sethoxydim-resistant zoysiagrass plants are regenerated, whole
plant resistance to sethoxydim can be conducted as herein described
(Examples 8 and 9). In addition, cross-resistance to other ACCase
inhibitor herbicides can be carried out as herein described (Example 10),
Example 25
Controlling Weedy Species Among Herbicide-Resistant Plants by Application
of an Herbicide
[0156] A plot containing both bermudagrass and sethoxydim-resistant
seashore paspalum is treated with 150 g a.i. ha.sup.-1 sethoxydim once a
week over a period of three months. Over the three month treatment
period, it is observed that the bermudagrass slowly dies out while the
sethoxydim-resistant paspalum continues to thrive, leaving the plot
populated with above 80% sethoxydim-resistant paspalum.
Example 26
Controlling Weedy Species Among Herbicide-Resistant Plants by Application
of a Combination Herbicide
[0157] A plot containing both bermudagrass and sethoxydim-resistant
seashore paspalum is treated with both 150 g a.i. ha.sup.-1 sethoxydim
and 150 g a.i. ha.sup.-1 fenoxaprop once a week over a period of three
months. Over the three month treatment period, it is observed that the
bermudagrass slowly dies out while the sethoxydim-resistant paspalum
continues to thrive, leaving the plot populated with above 80%
sethoxydim-resistant paspalum.
Example 27
Marker-Assisted Selection: Identifying Traits Suitable for Selection Using
Herbicide Resistance as a Marker
[0158] A tall fescue variety having several traits desirable for breeding
purposes is cultured as discussed herein (see Examples 15-19) to identify
sethoxydim-resistant callus lines of the variety. These lines are
regenerated to mature plants of generation R.sub.0. R.sub.0 plants having
the ACCase I1781L mutation, conferring sethoxydim resistance, are crossed
with a different tall fescue variety lacking the several traits. Through
subsequent crosses, certain of the desirable traits are shown to
segregate non-randomly with sethoxydim resistance. Through further
optional crosses, linkage between sethoxydim resistance and each of the
linked traits can be quantified. For each trait found to be linked to
sethoxydim resistance, such resistance is a useful marker for
marker-assisted breeding/selection protocols.
Example 28
Marker-Assisted Selection: Selecting a Desirable Linked Trait Based Upon
Marker Phenotype
[0159] Sethoxydim-resistant tall fescue plants from Example 27, of the
R.sub.0 generation or progeny of such generation, are used for
marker-assisted breeding and selection. A commercial variety of tall
fescue lacking one of the linked traits identified in Example 27 is
crossed with the sethoxydim-resistant tall fescue plants from Example 27
to form a hybrid generation. Seeds of the hybrid generation are
germinated and the plants are treated with sethoxydim at a level
sufficient to kill or severely retard the growth of non-resistant plants.
Healthy, sethoxydim-resistant plants are selected for further crosses. A
large proportion of such selected plants carry the linked trait. Further
generations of crosses between sethoxydim-resistant plants with plants of
the commercial variety, followed by sethoxydim treatment and selection,
result in a plant line having substantially the genetic background of the
commercial variety, but carrying the desirable trait that was confirmed
to be linked to sethoxydim resistance.
Example 29
Marker-Assisted Selection: Selecting a Desirable Linked Trait Based Upon a
Molecular Marker
[0160] Sethoxydim-resistant tall fescue plants from Example 27, of the
R.sub.0 generation or progeny of such generation, are used for
marker-assisted breeding and selection. A commercial variety of tall
fescue lacking one of the linked traits indentified in Example 27 is
crossed with the sethoxydim-resistant tall fescue plants from Example 27
to form a hybrid generation. Seeds of the hybrid generation are
germinated and samples from the germinated plants are screened by
molecular methods such as PCR for presence of the SNP associated with the
I1781L mutation. For example, the SV384F and SV384R primers (Example 6,
SEQ ID NOs: 1 and 2) can be used in an amplification assay to detect the
marker. Presence of the molecular marker in a hybrid plant confirms a
likelihood that the hybrid plant also carries the desirable traits linked
to sethoxydim resistance, as discussed in Example 27. Plants carrying the
molecular marker are selected for further crosses. A large proportion of
such selected plants carry the linked trait. Further generations of
crosses between plants having the marker, with plants of the commercial
variety, followed by either further molecular selection or by sethoxydim
treatment and selection, result in a plant line having substantially the
genetic background of the commercial variety, but carrying the desirable
trait that was confirmed to be linked to sethoxydim resistance.
[0161] The various methods and techniques described above provide a number
of ways to carry out the invention. Furthermore, the skilled artisan will
recognize the applicability of various features from different
embodiments. Similarly, the various elements, features and steps
discussed above, as well as other known equivalents for each such
element, feature or step, can be combined and/or modified by one of
ordinary skill in this art to perform methods in accordance with
principles described herein. Among the various elements, features, and
steps some will be specifically included and others specifically excluded
in diverse embodiments.
[0162] Although the invention has been disclosed in the context of certain
embodiments and examples, it will be understood by those skilled in the
art that the embodiments of the invention extend beyond the specifically
disclosed embodiments to other alternative embodiments and/or uses and
modifications and equivalents thereof.
[0163] Many variations and alternative elements have been disclosed in
embodiments of the present invention. Still further variations and
alternate elements will be apparent to one of skill in the art.
[0164] In some embodiments, the terms "a" and "an" and "the" and similar
references used in the context of describing a particular embodiment of
the invention (especially in the context of certain of the following
claims) can be construed to cover both the singular and the plural. The
recitation of ranges of values herein is merely intended to serve as a
shorthand method of referring individually to each separate value falling
within the range. Unless otherwise indicated herein, each individual
value is incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in any
suitable order unless otherwise indicated herein or otherwise clearly
contradicted by context. The use of any and all examples, or exemplary
language (e.g. "such as") provided with respect to certain embodiments
herein is intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention otherwise claimed. No
language in the specification should be construed as indicating any
non-claimed element essential to the practice of the invention.
[0165] Groupings of alternative elements or embodiments of the invention
disclosed herein are not to be construed as limitations. Each group
member can be referred to and claimed individually or in any combination
with other members of the group or other elements found herein. One or
more members of a group can be included in, or deleted from, a group for
reasons of convenience and/or patentability. When any such inclusion or
deletion occurs, the specification is herein deemed to contain the group
as modified thus fulfilling the written description of all Markush groups
used in the appended claims.
[0166] Preferred embodiments of this invention are described herein,
including the best mode known to the inventors for carrying out the
invention. Variations on those preferred embodiments will become apparent
to those of ordinary skill in the art upon reading the foregoing
description. It is contemplated that skilled artisans can employ such
variations as appropriate, and the invention can be practiced otherwise
than specifically described herein. Accordingly, many embodiments of this
invention include all modifications and equivalents of the subject matter
recited in the claims appended hereto as permitted by applicable law.
Moreover, any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
[0167] Furthermore, numerous references have been made to patents and
printed publications throughout this specification. Each of the above
cited references and printed publications are herein individually
incorporated by reference in their entirety.
[0168] In closing, it is to be understood that the embodiments of the
invention disclosed herein are illustrative of the principles of the
present invention. Other modifications that can be employed can be within
the scope of the invention. Thus, by way of example, but not of
limitation, alternative configurations of the present invention can be
utilized in accordance with the teachings herein. Accordingly,
embodiments of the present invention are not limited to that precisely as
shown and described.
Sequence CWU
1
1
5119DNAArtificial SequenceSynthetic Oligonucleotide Primer 1cggggttcag
tacatttat
19221DNAArtificial SequenceSynthetic Oligonucleotide Primer 2gatcttagga
ccacccaact g
21328DNAArtificial SequenceSynthetic Oligonucleotide Primer 3aattcctgtt
ggtgtcatag ctgtggag
28428DNAArtificial SequenceSynthetic Oligonucleotide Primer 4ttcagattta
tcaactctgg gtcaagcc
2851112DNAArtificial SequenceAmplified PCR product 5ggcgattggg ccgaagtcgc
atgctcccgg ccgccatggc ggccgcggga attcgatacc 60cctttttcag tacatttatc
tgactgaaga agattatgct cgtattagct cttctgttat 120agcacataag ctacagctgg
acagcggtga aattaggtgg attattgact ctgttgtggg 180caaggaggat gggcttggtg
ttgagaattt acatggaagt gctgctattg ccagtgctta 240ttctagggca tacgaggaga
catttacact tacgttcgtg actgggcgga ctgtaggaat 300aggagcttat cttgcacgac
ttggtatacg gtgcatacag cgtcttgacc agcccattat 360tttaacaggg ttttctgccc
tgaacaagct tcttgggcgt gaagtttaca gctcccacat 420gcagttgggt ggtcctaaga
tcatggcgac gaatggtgtt gtccacctca ctgtttcaga 480tgatcttgaa ggtgtatcca
gtatattgag gtggctcagc tatgttcctg ccaacattgg 540tggacctctt cctattacaa
aacctttgga cccaccggac agacctgttg cgtacatccc 600tgagaacaca tgcgatccac
gtgcagccat ccgtggtgta gatgacagcc aagggcaatg 660gttgggtggt atgtttgaca
aagacagctt tgtggagaca tttgaaggat gggcgaaaac 720agttgtcact ggcagggcat
agcttggagg aattcctgtg ggtgtcatag ctgtggagac 780acagaacatg atgcagctca
tccctgctga tccaggccag cttgattctc atgagcgatc 840tgttcctcgg gctgaacaag
tgtggttccc agattctgca accaagactg ctcaagcatt 900gttggacttc aaccgtgaag
gattgcctct gttcatcctt gctaactgga gaggtttctc 960tggtggacaa agagatctct
ttgaaggaat tcttcaggct gggtcaacaa ttgttgagaa 1020ccttaggacg tacaatcaac
ctgcgtttgt ctacattcct atggctggag agctgcgtgg 1080aggagcttgg gttgtggttg
atagcaaaat aa 1112
* * * * *