![[Help]](/netaicon1/PTO/help.gif)
![[Home]](/netaicon1/PTO/home.gif)
![[Boolean Search]](/netaicon1/PTO/boolean.gif)
![[Manual]](/netaicon1/PTO/manual.gif)
![[Number Search]](/netaicon1/PTO/number.gif)
![[PTDLs]](/netaicon1/PTO/ptdl.gif)
![[CURR_LIST]](/netaicon1/PTO/hitlist.gif)
![[Shopping Cart]](/netaicon1/PTO/cart.gif)
![[Order Copy]](/netaicon1/PTO/order.gif)
![[Image]](/netaicon1/PTO/image.gif)
| United States Patent Application |
20070122826
|
| Kind Code
|
A1
|
|
Glass; John I.
; et al.
|
May 31, 2007
|
Minimal bacterial genome
Abstract
The present invention relates, e.g., to a minimal set of protein-coding
genes which provides the information required for replication of a
free-living organism in a rich bacterial culture medium, wherein (1) the
gene set does not comprise the 101 genes listed in Table 2; and/or
wherein (2) the gene set comprises the 381 protein-coding genes listed in
Table 3 and, optionally, one of more of: a set of three genes encoding
ABC transporters for phosphate import (genes MG410, MG411 and MG412; or
genes MG289, MG290 and MG291); the lipoprotein-encoding gene MG185 or
MG260; and/or the glycerophosphoryl diester phosphodiesterase gene MG293
or MG385.
| Inventors: |
Glass; John I.; (Germantown, MD)
; Smith; Hamilton O.; (Reisterstown, MD)
; Hutchison; Clyde A. III; (Rockville, MD)
; Alperovich; Nina Y.; (Germantown, MD)
; Assad-Garcia; Nacyra; (Rockville, MD)
|
| Correspondence Address:
|
VENABLE LLP
P.O. BOX 34385
WASHINGTON
DC
20043-9998
US
|
| Assignee: |
J. Craig Venter Institute, Inc.
Rockville
MD
20850
|
| Family ID:
|
37704463
|
| Appl. No.:
|
11/546364
|
| Filed:
|
October 12, 2006 |
Related U.S. Patent Documents
| | | | |
|---|
|
| Application Number | Filing Date | Patent Number |
|---|
| | 60725295 | Oct 12, 2005 | |
|
|
| Current U.S. Class: |
435/6.18 ; 435/161; 435/169; 435/189; 435/252.3; 536/23.2 |
| Current CPC Class: |
C07K 14/195 20130101; C07K 14/30 20130101; C12P 3/00 20130101; C12P 7/06 20130101; Y02E 50/17 20130101; C12N 1/20 20130101; C12N 9/16 20130101; C12R 1/35 20130101; C12Y 301/04046 20130101 |
| Class at Publication: |
435/006 ; 435/161; 435/169; 435/252.3; 435/189; 536/023.2 |
| International Class: |
C40B 30/06 20060101 C40B030/06; C40B 40/10 20060101 C40B040/10; C07H 21/04 20060101 C07H021/04; C12P 7/06 20060101 C12P007/06; C12P 1/06 20060101 C12P001/06; C12N 9/02 20060101 C12N009/02; C12N 1/21 20060101 C12N001/21 |
Goverment Interests
[0002] Aspects of this invention were made with government support (DOE
grant number DE-FG02-02ER63453). The government has certain rights in the
invention.
Claims
1. A set of protein-coding genes that provides the information required
for growth and replication of a free-living organism under axenic
conditions in a rich bacterial culture medium, wherein the set lacks at
least 40 of the 101 protein-coding genes listed in Table 2, or functional
equivalents thereof, wherein at least one of the genes in Table 4 is
among the lacking genes; wherein the set comprises between 350 and 381
of the 381 protein-coding genes listed in Table 3, or functional
equivalents thereof, including at least one of the genes in Table 5; and
wherein the set comprises no more than 450 protein-coding genes.
2. The set of claim 1, which lacks at least 55 of the genes listed in
Table 2.
3. The set of claim 1, which lacks at least 70 of the genes listed in
Table 2.
4. The set of claim 1, which lacks at least 80 of the genes listed in
Table 2.
5. The set of claim 1, which lacks at least 90 of the genes listed in
Table 2.
6. The set of any of claims 1-5, which comprises at least 360 of the
genes listed in Table 3.
7. The set of any of claims 1-5, which comprises at least 370 of the
genes listed in Table 3.
8. The set of any of claims 1-5, which comprises at least 380 of the
genes listed in Table 3.
9. A set comprising the set of any of claims 1-8, and further comprising
genes encoding an ABC transporter for phosphate import, selected from the
group consisting of (a) MG410, MG411 and MG412, and (b) MG289, MG290 and
MG291, and functional equivalents thereof.
10. A set comprising the set of any of claims 1-9, and further comprising
a lipoprotein-encoding gene selected from the group consisting of MG185
and MG260, and functional equivalents thereof.
11. A set comprising the set of any of claims 1-10, and further
comprising a glycerophosphoryl diester phosphodiesterase gene selected
from the group consisting of MG293 and MG385, and functional equivalents
thereof.
12. A set comprising the set of any of claims 1-11, and further
comprising the 43 RNA-coding genes of Mycoplasma genitalium , or
functional equivalents thereof.
13. The set of any of claims 1-12, wherein the genes constitute a
chromosome.
14. The set of any of claims 1-13, wherein the genes are from Mycoplasma
genitalium.
15. A set comprising the set of any of claims 1-14, and further
comprising at least one gene involved in hydrogen or ethanol production.
16. The set of any of claims 1-15, which are in a free-living organism.
17. The set of any of claims 1-15, which are in a free-living organism
that is growing and replicating in a rich bacterial culture medium.
18. The set of claim 17, wherein the rich bacterial culture medium is
SP4.
19. The set of any of claims 1-15, which are recorded on a computer
readable medium.
20. A free-living organism that can grow and replicate under axenic
conditions in a rich bacterial culture medium, whose set of genes
consists of the set of any of claims 1-15.
21. The free-living organism of claim 20, wherein the rich bacterial
culture medium is SP4.
22. A method for determining the function of a gene, comprising inserting
the gene into, mutating the gene in, or removing the gene from the
free-living organism of claim 20 or 21, and measuring a property of the
organism.
23. A free-living organism that comprises the set of claim 15.
24. A method of hydrogen or ethanol production, comprising growing the
organism of claim 23 in a suitable medium such that hydrogen or ethanol
is produced.
25. The set of any of claims 1-15, wherein the genes constitute a library
of DNA molecules.
26. A method comprising combining a plurality of DNA molecules to create
the library of claim 25.
27. A method comprising combining all the DNA molecules of the library of
claim 25 into an assembled DNA molecule.
28. The method of claim 27, wherein the assembled DNA molecule is a
genome.
Description
[0001] This application claims the benefit of the filing date of U.S.
provisional application 60/725,295, filed Oct. 12, 2005, which is
incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
[0003] This invention relates, e.g., to the identification of
non-essential genes of bacteria, and of a minimal set of genes required
to support viability of a free-living organism.
BACKGROUND INFORMATION
[0004] One consequence of progress in the new field of synthetic biology
is an emerging view of cells as assemblages of parts that can be put
together to produce an organism with a desired phenotype (1). That
perspective begs the question: "How few parts would it take to construct
a cell?" In an environment that is free from stress and provides all
necessary nutrients, what would comprise the simplest free-living
organism? This problem has been approached theoretically and
experimentally in our laboratory and elsewhere.
[0005] In a comparison of the first two bacterial genomes sequenced,
Mushegian and Koonin projected that the 256 orthologous genes shared by
the Gram negative Haemophilus influenzae and the Gram positive M
genitalium genomes are a close approximation of a minimal gene set for
bacterial life (2). More recently Gil et al. proposed a 206
protein-coding gene core of a minimal bacterial gene set based on
analysis of several free-living and endosymbiotic bacterial genomes (3).
[0006] In 1999 some of the present inventors reported the first use of
global transposon mutagenesis to experimentally determine the genes not
essential for laboratory growth of M genitalium (4). Since then there
have been numerous other experimental determinations of bacterial
essential gene sets using our approach and other methods such as site
directed gene knockouts and antisense RNA (5-12). Most of these studies
were done with human pathogens, often with the aim of identifying
essential genes that might be used as antibiotic targets. Almost all of
these organisms contain relatively large genomes that include many
paralogous gene families. Disruption or deletion of such genes shows they
are non-essential but does not determine if their products perform
essential biological functions. It is only through gene essentiality
studies of bacteria that have near minimal genomes that we bring
empirical verification to the compositions of hypothetical minimal gene
sets.
[0007] The Mollicutes, generically known as the mycoplasmas, are an
excellent experimental platform for experimentally defining a minimal
gene set. These wall-less bacteria evolved from more conventional
progenitors in the Firmicutes taxon by a process of massive genome
reduction. Mycoplasmas are obligate parasites that live in relatively
unchanging niches requiring little adaptive capability. M genitalium , a
human urogenital pathogen, is the extreme manifestation of this genomic
parsimony, having only 482 protein-coding genes and the smallest genome
at .about.580 kb of any known free-living organism capable of being grown
in pure culture (13). The bacteria can grow independently on an agar
plate free of other living cells. While more conventional bacteria with
larger genomes used in gene essentiality studies have on average 26% of
their genes in paralogous gene families, M genitalium has only 6% (Table
1). Thus, with its lack of genomic redundancy and contingencies for
different environmental conditions, M genitalium is already close to
being a minimal bacterial cell.
[0008] The 1999 report by some of the present inventors on the essential
microbial gene for M genitalium and its closest relative, Mycoplasma
pneumoniae, mapped .about.2200 transposon insertion sites in these two
species, and identified 130 putatively non-essential M genitalium
protein-coding genes or M pneumoniae orthologs of M genitalium genes. In
that report (Hutchison et al. (1999) Science 286, 2165-9), those authors
estimated that 265 to 350 of the protein-coding genes of M genitalium are
essential under laboratory growth conditions (4). However proof of gene
dispensability requires isolation and characterization of pure clonal
populations, which they did not do. In that report, the authors grew
Tn4001 transformed cells in mixed pools for several weeks, and then
isolated genomic DNA from those mixtures of mutants. They sequenced
amplicons from inverse PCRs using that DNA as a template to identify the
transposon insertion sites in the mycoplasma genomes. Most of the genes
containing transposon insertions encoded either hypothetical proteins or
other proteins not expected to be essential. Nonetheless, some of the
putatively disrupted genes, such as isoleucyl and tyrosyl-tRNA
synthetases (MG345 & MG455), DNA replication gene dnaA (MG469), and DNA
polymerase III, subunit alpha (MG261) are thought to perform essential
functions. They hypothesized how genes generally thought to be essential
might be disrupted: a gene may be tolerant of the transposon insertion
and not actually disrupted, cells could contain two copies of a gene, or
the gene product may be supplied by other cells in the same mixed pool of
mutants.
[0009] Disclosed herein is an expanded study in which we have isolated
and characterized M genitalium Tn4001 insertion mutants that were present
in individual colonies picked from agar plates. This analysis has
provided a new, more thorough, estimate of the number of essential genes
in this minimalist bacterium.
DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1 shows the accumulation of new disrupted M genitalium genes
(top line, thick) and new transposon insertion sites in the genome
(bottom line, thin) as a function of the total number of analyzed primary
colonies and subcolonies with insertion sites different from that of the
parental primary colony.
[0011] FIGS. 2A-21 show global transposon mutagenesis of M genitalium .
The locations of transposon insertions from the current study are noted
by a .DELTA. below the insertion site on the map. The letters over the
Gene Loci (MG###) refer to the functional category of the gene product as
listed.
TABLE-US-00001
A Biosynthesis of cofactors, prosthetic grps, and
carriers
B Purines, pyrimidines, nucleosides, and
nucleotides
C Cell envelope
D Cellular processes
E Central intermediary metabolism
F DNA metabolism
G Energy metabolism
H Fatty acid and phospholipid metabolism
I Hypothetical proteins
J Protein fate
K Protein synthesis
L Regulatory functions
M Transcription
N Transport and binding proteins
X Unknown function
P cell/organism defense
R rRNA and tRNA genes
[0012] FIG. 3 shows the frequency of Tn4001 tet insertions. These
histograms show the frequency we identified mutants with transposon
insertions at different sites in the genome. The abscissa is the M
genitalium genome site where the transposon inserts. Some mutations
proved to be highly prone to transposon migration. In subcolonies with
insertion sites different than the primary clone there was a preference
to jump to a region of the genome from .about.350,000 to 500,000 base
pairs rich in topological features such as pallindromic regions and
cruciform elements (van Noort et al. (2003) Trends Genet 19, 365-369).
[0013] FIG. 4 shows metabolic pathways and substrate transport mechanisms
encoded by M genitalium . White letters on black boxes mark non-essential
functions or proteins based on our current gene disruption study.
Question marks denote enzymes or transporters not identified that would
be necessary to complete pathways, and those missing enzyme and
transporter names are italicized. Transporters are drawn spanning the
cell membrane. The arrows indicate the predicted direction of substrate
transport. The ABC type transporters are drawn with a rectangle for the
substrate-binding protein, diamonds for the membrane-spanning permeases,
and circles for the ATP-binding subunits.
DESCRIPTION OF THE INVENTION
[0014] The inventors have identified 101 protein-coding genes that are
non-essential for sustaining the growth of an organism, such as a
bacterium, in a rich bacterial culture medium, e.g. SP4. Such a culture
medium contains all of the salts, growth factors, nutrients etc. required
for bacterial growth under laboratory conditions. A minimal set of genes
required for sustaining the viability of a free-living organism under
laboratory conditions is extrapolated from the identification of these
non-essential genes. By a "minimal gene set" is meant the minimal set of
genes whose expression allows the viability (e.g., survival, growth,
replication, proliferation, etc.) of a free-living organism in a
particular rich bacterial medium as discussed above.
[0015] The 101 protein-coding genes of M genitalium that were disrupted
in the bacteria and nevertheless retained viability, and are thus
dispensable (non-essential) for growth, are listed in Table 2, where they
are grouped by their functional roles. The 381 genes that were not
disrupted are summarized in Table 3, where they are also grouped by
functional roles. These genes form part of a minimal essential gene set.
Other genes may also be part of a minimal gene set. At minimum, these
other genes include protein-coding genes for ABC transporters for
phosphate and/or phosphonate, and certain lipoproteins and/or
glycerophosphoryl diester phosphodiesterases; and RNA-encoding genes.
[0016] As noted above, the some of the present inventors published a
preliminary study in 1999 that reported putative sets of genes that
appeared to be either essential or disposable for viability. Table 4
lists genes identified in the present study as being dispensable, but
which were not so identified in the 1999 paper. Table 5 lists genes
identified in the present study as being required for growth, but which
were not so identified in the 1999 paper.
[0017] One aspect of the invention is a set of protein-coding genes that
provides the information required for replication of a free-living
organism under axenic conditions in a rich bacterial culture medium, such
as SP4, (e.g., a minimal set of protein-coding genes),
[0018] wherein the gene set lacks at least 40 of the 101 protein-coding
genes listed in Table 2 (the "lacking genes"), or functional equivalents
thereof, wherein at least one of the genes in Table 4 is among the
lacking genes;
[0019] wherein the set comprises between 350 and 381 of the 381
protein-coding genes listed in Table 3, or functional equivalents
thereof, including at least one of the genes in Table 5; and
[0020] wherein the set comprises no more than 450 protein-coding genes.
[0021] A set of genes that "provides the information" required for
replication of a free-living organism can be in any form that can be
transcribed (e.g. into mRNA, rRNA or tRNA) and, in the case of
protein-encoding sequences, translated into protein, wherein the
transcription/translation products provide functions that allow the
free-living organism to function.
[0022] This set of protein-coding genes is smaller than the complete
complement of genes found in M genitalium (482 genes), the smallest known
set of naturally occurring genes in a free-living organism.
[0023] A set of protein-coding genes of the invention can lack at least
about 55 (e.g. at least about, 70, 80 or 90) of the genes listed in Table
2), and/or it can comprise at least about 360 (e.g. at least about 370 or
380) of the genes listed in Table 3.
[0024] A set of the invention can further comprise:
[0025] genes encoding an ABC transporter for phosphate import, selected
from the group consisting of (a) MG410, MG411 and MG412, and (b) MG289,
MG290 and MG291, and functional equivalents thereof; and/or
[0026] a lipoprotein-encoding gene selected from the group consisting of
MG185 and MG260, and functional equivalents thereof; and/or
[0027] a glycerophosphoryl diester phosphodiesterase gene selected from
the group consisting of MG293 and MG385, and functional equivalents
thereof.
[0028] Furthermore, a set of the invention can further comprise the 43
RNA-coding genes of Mycoplasma genitalium , or functional equivalents
thereof.
[0029] The genes in a set of the invention may constitute a chromosome;
and/or may be from M. genitalium.
[0030] Another aspect of the invention is a free-living organism that can
grow and replicate under axenic conditions in a rich bacterial culture
medium (such as SP4), whose set of genes consists of a set of the
invention, e.g. a set that comprises at least one gene involved in
hydrogen or ethanol production.
[0031] Another aspect of the invention is a method for determining the
function of a gene, comprising inserting, mutating or removing the gene
into/in/from such a free-living organism, and measuring a property of the
organism.
[0032] Another aspect of the invention is a method of hydrogen or ethanol
production, comprising growing a free-living organism of that invention
that comprises at least one gene involved in hydrogen or ethanol
production, in a suitable medium such that hydrogen or ethanol is
produced.
[0033] Another aspect of the invention is an effective subset of a set as
noted above. An "effective subset," as used herein, refers to a subset
that provides the information required for replication of a free-living
organism in a rich bacterial culture medium, such as SP4.
[0034] A minimal gene set of the invention has a variety of applications.
For example, a minimal gene set of the invention can be introduced into
cells of a microorganism, such as a bacterium, which lack a genome or a
functional genome (e.g. ghost cells) and used experimentally to
investigate requirements for cell growth, protein synthesis, replication
or other bacterial functions under varying conditions. One or more of the
minimal genes in the ghost cells can be modified or substituted with
orthologous genes or genes or substituted with non-orthologous genes that
express proteins which perform the same function(s), to allow
structure/function studies of those genes. Cells comprising a minimal
gene set of the invention can be modified to further comprise one or more
expressible heterologous genes, either integrated into the genome or
replicating on one or more independent plasmids. These cells can be used,
e.g., to study properties or activities of the heterologous genes (e.g.,
structure/function studies), or to produce useful amounts of the
heterologous proteins (e.g. biologic drugs, vaccines, catalytic enzymes,
energy sources, etc).
[0035] As noted, a minimal gene set is one that provides the information
required for replication of a free-living organism in a rich bacterial
culture medium. The minimal gene set described herein was identified
based on genes that were shown to be non-essential for bacterial growth
in the medium SP4 (whose composition is described in reference #17), in
the presence of tetracycline selection (the tetM tetracycline resistance
gene is present in the transposon used to inactivate the genes which were
shown to be non-essential). The set of non-essential genes may be
different for organisms grown under different conditions (e.g. in
different bacterial medium, under different selection conditions, etc).
In general, a culture medium that supports growth and proliferation of a
minimal organism (containing a gene set as discussed herein), with as few
environmental stresses as possible, contains energy sources such as
glucose, arginine or urea; protein or peptides; all amino acids;
nucleotides; vitamins; cofactors; fatty acids and other membrane
components such as cholesterol; enzyme cofactors; salts; minerals and
buffers.
[0036] Such a medium is SP4 (Spiroplasma medium), which is a highly
nutritious mixture of beef heart infusion, peptone supplemented with
yeast extract, CMRL 1066 Medium and 17% fetal bovine serum. The yeast
extract provides diphosphopyridine nucleotides and the serum provides
cholesterol and a source of protein. (See, e.g., Tully et al. (1979) J.
Infect. Dis 139, 478-82.) In particular, SP4 medium contains the
following components:
TABLE-US-00002
Mix
Mycoplasma Broth Base 3.5 g
Bacto Tryptone 10 g
Bacto Peptone 5.3 g
Distilled water 600 ml
[0037] Adjust pH to 7.5
[0038] Autoclave at 121.degree. C. for 15 min
TABLE-US-00003
Add Aseptically
20% Glucose 25 ml
CMRL 1066 (10X) 50 ml
7.5% Sodium Bicarbonate 14.6 ml
200 mM L-Glutamine 5 ml
Yeast extract Solution 35 ml
2% Autoclaved TC Yeastolate 100 ml
Fetal Bovine Serum (Heat inactivated) 170 ml
Penicillin G (10.sup.7 IU/ml) 100 .mu.l
[0039]
TABLE-US-00004
CMRL 1066 Components
1X
Chemical Molarity (mM)
Calcium chloride (CaCl2--2H2O) 1.800
Potassium Chloride (KCl) 5.300
Magnesium sulfate (MgSO4) 0.814
Sodium chloride (NaCl) 116.000
Sodium phosphate, mono (NaH2PO4) 1.010
Thiamine pyrophosphate 0.0021
Coenzyme A 0.00326
2'-deoxyadenosine 0.0398
2'-deoxycytidine 0.4441
2'-deoxyguanosine 0.0375
Beta-nicotinamide adenine dinucleotide 0.0105
Flavin adenine dinucleotide 0.00127
D-Glucose 3.33000
Glutathione reduced 0.0325
5-Methyl-2'-deoxycytidine 0.0004
Phenol red 0.0502
Sodium acetate-3H2O 0.6100
d-Glucuronic acid 0.0177
Thymidine 0.0413
beta-nicotinamide adenine dinucleotide 0.0013
phosphate
Tween 80 5 mg/L
Uridine-5'-triphosphate 0.0020
L-Alanine 0.281
L-Arginine 0.330
L-Aspartic acid 0.230
L-Cystine 1.480
L-Cysteine 0.108
L-Glutamic 0.510
Glycine 0.667
L-Histidine 0.952
trans-4-Hydroxy-L-proline 0.763
L-Isoleucine 0.153
L-Leucine 0.458
L-Lysine 0.383
L-Methionine 0.101
L-Phenylalanine 0.152
L-Proline 0.348
L-Serine 0.238
L-Threonine 0.252
L-Tryptophan 0.049
L-Tyrosine disodium salt 0.260
L-Valine 0.214
Biotin 0.000041
D-Pantothenic acid hemicalcium salt 0.000021
Choline Chloride 0.0035
Folic acid 0.0000227
myo-inositol 0.0002
Niacinamide 0.00203
Niacin 0.0002
4-Aminobenzoic Acid 0.0003
Pyridoxal Hydrochloride 0.0001
Pyridoxine Hydrochloride 0.00012
Riboflavin 0.0000266
Thiamine hydrochloride 0.0000297
Ascorbic Acid 0.284
Cholesterol 0.000517
Sodium bicarbonate (NaHCO3) 26.200
L-Glutamine 2.000
[0040] The term "gene," as used herein, refers to a polynucleotide
comprising a protein-coding or RNA-coding sequence, in an expressible
form, e.g. operably linked to an expression control sequence. The "coding
sequences" of the gene generally do not include expression control
sequences, unless they are embedded within the coding sequence. In
different embodiments of the invention, the coding sequences of the genes
listed in Tables 2 to 5 can be under the control of the naturally
occurring expression control sequences or they can be under the control
of heterologous expression control sequences, or combinations thereof.
[0041] An "expression control sequence," as used herein, refers to a
polynucleotide sequence that regulates expression of a polypeptide coded
for by a polynucleotide to which it is functionally ("operably") linked.
Expression can be regulated at the level of the mRNA or polypeptide.
Thus, the term expression control sequence includes mRNA-related elements
and protein-related elements. Such elements include promoters, domains
within promoters, ribosome binding sequences, transcriptional
terminators, etc. An expression control sequence is operably linked to a
nucleotide sequence when the expression control sequence is positioned in
such a manner to effect or achieve expression of the coding sequence. For
example, when a promoter is operably linked 5' to a coding sequence,
expression of the coding sequence is driven by the promoter.
[0042] The minimal gene set suggested in the Examples herein is composed
of genes or sequences from Mycoplasma genitalium (M. genitalium ) G37
(ATCC 33530). The complete genome of this bacterium is provided as
Genbank accession number L43976. The individual genes are annotated in
the Genbank listing as MG001, MG002 through MG470. The sequences of the
genes were published on the TIGR web site in early October, 2005.
[0043] However, any of a variety of other protein- or RNA-coding genes or
sequences can be substituted in a minimal gene set for the exemplified
protein- or RNA-coding gene or sequences, provided that the protein or
RNA encoded by the substituting gene can be expressed and that it
provides a sufficient amount of the activity, function and/or structure
to substitute for the M genitalium gene or sequence in a minimal gene
set. Such substitutes are sometimes referred to herein as "functional
equivalents" of the exemplified genes or coding sequences.
[0044] Suitable genes or coding sequences that can be substituted
include, for example, an active mutant, variant, polymorph etc. of a M
genitalium gene; or a corresponding (orthologous) gene from another
bacterium, such as a different Mycoplasma species (e.g., M. capricolum).
Furthermore, genes or sequences from the minimal gene set can be
substituted with orthologous genes from an evolutionarily more diverse
organism, such as an archaebacterium or a eukaryotic organism. Genes from
eukaryotic organisms which must be post-translationally modified in order
to function by a mechanism unavailable in a bacterial host cannot, of
course, be used. Similarly, expression control sequences from eukaryotic
genes can be used only if they can function in the background of a
bacterial cell.
[0045] In one embodiment of the invention, genes from the minimal gene
set are replaced by non-orthologous gene displacement (by a different set
of genes providing an equivalent function or activity). For example,
genes from the glycolytic pathway of M genitalium as shown in the
Examples can be substituted with genes from a different organism that
utilizes a different source for generating energy (such as hydrolysis of
urea, fermentation of arginine, etc.).
[0046] For example, M genitalium generates energy via glycolysis. One can
substitute a different energy generation system from another organism
that would make most of the genes that express the enzymes of the
glycolytic pathway superfluous. For instance energy generation in
Ureaplasma parvum, a bacterium closely related to M genitalium is based
on the hydrolysis of urea. That system includes 8 genes that encode the
urease enzyme complex, two ammonium transporters, and as yet unidentified
nickel ion transporter (presumably one of several U parvum cation
transporters), and possibly a urea transporter (no transporter has been
identified, and the very small urea molecule may enter the cell by
diffusion). We expect that substitution of these 11-12 U parvum genes for
15-20 M genitalium genes encoding glycolytic enzymes and carbohydrate
transporters would produce an organism with fewer genes capable more
robust growth as is seen with U parvum.
[0047] As used herein, the term "polynucleotide" includes a single
stranded DNA corresponding to the single strand provided in the Genbank
listing, or to the complete complement thereto, or to the double stranded
form of the molecule. Also included are RNA and DNA-like or RNA-like
materials, such as branched DNAs, peptide nucleic acids (PNA) or locked
nucleic acids (LNA).
[0048] Functional equivalents of genes can also include a variety of
variant polynucleotides, provided that the variant polynucleotide can
provide at least a measurable amount of the function of the original
polynucleotide from which it varies. Preferably, the variant can provide
at least about 50%, 75%, 90% or 95% of the function of the original
polynucleotide. For example, a functional variant of a polynucleotide as
described herein includes a polynucleotide that includes degenerate
codons; or that is an active fragment of the original polynucleotide; or
that exhibits at least about 90% identity (e.g. at least about 95% or 98%
identity) with the original polynucleotide; or that can hybridize
specifically to the original polynucleotide under conditions of high
stringency.
[0049] Unless otherwise indicated, the term "about," as used herein,
refers to plus or minus 10%. Thus, about 90%, as used above, includes 81%
to 99%. As used herein, the end points of a range are included with the
range.
[0050] Functional variant polynucleotides may take a variety of forms,
including, e.g., naturally or non-naturally occurring polymorphisms,
including single nucleotide polymorphisms (SNPs), allelic variants, and
mutants. They may comprise, e.g., one or more additions, insertions,
deletions, substitutions, transitions, transversions, inversions,
chromosomal translocations, variants resulting from alternative splicing
events, or the like, or any combinations thereof.
[0051] The degree of sequence identity can be obtained by conventional
algorithms, such as those described by Lipman and Pearson (Proc. Natl.
Acad. Sci. 80:726-730, 1983) or Martinez/Needleman-Wunsch (Nucl Acid
Research 11:4629-4634, 1983).
[0052] A polynucleotide that hybridizes specifically to a second
polynucleotide under conditions of high stringency hybridizes
preferentially to that polynucleotide. Conditions of "high stringency,"
as used herein, means, for example, incubating a blot or other
hybridization reaction overnight (e.g., at least 12 hours) with a long
polynucleotide probe in a hybridization solution containing, e.g., about
5.times.SSC, 0.5% SDS, 100 .mu.g/ml denatured salmon sperm DNA and 50%
formamide, at 42.degree. C. Blots can be washed at high stringency
conditions that allow, e.g., for less than 5% bp mismatch (e.g., wash
twice in 0.1.times.SSC and 0.1% SDS for 30 min at 65.degree. C.), thereby
selecting sequences having, e.g., 95% or greater sequence identity. Other
non-limiting examples of high stringency conditions include a final wash
at 65.degree. C. in aqueous buffer containing 30 mM NaCl and 0.5% SDS.
Another example of high stringent conditions is hybridization in 7% SDS,
0.5 M NaPO.sub.4, pH 7, 1 mM EDTA at 50.degree. C., e.g., overnight,
followed by one or more washes with a 1% SDS solution at 42.degree. C.
Whereas high stringency washes can allow for less than 5% mismatch,
reduced or low stringency conditions can permit up to 20% nucleotide
mismatch. Hybridization at low stringency can be accomplished as above,
but using lower formamide conditions, lower temperatures and/or lower
salt concentrations, as well as longer periods of incubation time.
[0053] The minimal gene set suggested herein has been derived by taking
into account some of the following factors. Furthermore, the minimal gene
set may be modified, e.g. for growth under other culture conditions,
taking into account some of the following factors:
[0054] Although the noted protein-coding genes appear to be essential for
growth under the conditions of the experiments described herein,
additional protein-coding genes may be required under other conditions.
For example, we isolated mutants in DNA metabolism genes that were
expendable for the duration of our experiment, but might be necessary for
the long-term survival of the organism. These were six genes involved in
recombination and DNA repair: recA (MG339), recU (MG352), Holliday
junction DNA helicases ruvA (MG358) and ruvB (MG359),
formamidopyrimidine-DNA glycosylase mutM (MG262.1), which excises
oxidized purines from DNA, and a likely DNA damage inducible protein gene
(MG360). Perhaps because of an accumulation of cell damage over time,
mutants in chromosome segregation protein SMC (MG298) and hypothetical
gene MG115, which is similar to the cinA gene of Streptococcus pneumoniae
competence-inducible (cin) operon, grew more poorly after repeated
passage.
[0055] Even with its near minimal gene set M genitalium has apparent
enzymatic redundancy. We disrupted two complete ABC transporter gene
cassettes for phosphate (MG410, MG411, MG412) and putatively phosphonate
(MG289, MG290, MG291) import. The PhoU regulatory protein gene (MG409)
was not disrupted, suggesting it is needed for both cassettes. Phosphate
is an essential metabolite that must be imported. Either phosphate might
be imported by both transporters as a result of relaxed substrate
specificity by the phosphonate system, or there is a metabolic capacity
to interconvert phosphate and phosphonate. Although we disrupted both of
these three gene cassettes, cells presumably need at least one phosphate
transporter. Therefore, a minimal gene set preferably contains three ABC
transporter genes for phosphate importation. Relaxed substrate
specificity is a recurring theme proposed and shown for several M
genitalium enzymes as a mechanism by which this bacterium meets its
metabolic needs with fewer genes (21, 22).
[0056] M genitalium generates ATP through glycolysis, and although none
of the genes encoding enzymes involved in the initial glycolytic
reactions were disrupted, mutations in two energy generation genes
suggested there may be still more unexpected genomic redundancy in this
essential pathway. We identified viable insertion mutants in genes
encoding lactate/malate dehydrogenase (MG460) and the dihydrolipoamide
dehydrogenase subunit of the pyruvate dehydrogenase complex (MG271).
Mutations in either of these dehydrogenases would be expected to have
glycolytic ATP production, and unbalanced NAD.sup.+ and NADH levels,
which are the primary oxidizing and reducing agents in glycolysis. These
mutations should have greatly reduced growth rate and accelerated
acidification of the growth medium While the MG271 mutants grew about 20%
slower than wild type cells, inexplicably, the lactate dehydrogenase
mutants grow .about.20% faster. We also isolated a mutant in
glycerol-3-phospate dehydrogenase (MG039), a phospholipid biosynthesis
enzyme. The loss of functions in these mutants could have been
compensated for by other M genitalium dehydrogenases or reductases. This
could be another case of mycoplasma enzymes having a relaxed substrate
specificity as has been reported for lactate/malate dehydrogenase (21)
and nucleotide kinases (22).
[0057] Under our laboratory conditions we identified 101 non-essential
protein-coding genes. It appears that the remaining 381 M genitalium
protein-coding genes, plus three phosphate transporter genes, and 43
RNA-coding genes comprise the essential genes set for this minimal cell
(Table 3). We disrupted genes in only 5 of the 12 M genitalium paralogous
gene families. Only for the two families comprised of lipoproteins MG185
and MG260 and glycerophosphoryl diester phosphodiesterases MG293 and
MG385 did we disrupt all members. Accordingly, these families' functions
may be essential, and we expanded our projection of the essential gene
set to 386 genes to include them (one each of MG185 or MG260, and one
each of MG 293 and MG385). This is a significantly greater number of
essential genes than the 265-350 predicted in the inventors' previous
study of M genitalium (4), or in the gene knockout/disruption study that
identified 279 essential genes in B. subtilis, which is a more
conventional bacterium from the same Firmicutes taxon as M genitalium
(6). Similarly, our finding of 386 essential protein-coding genes greatly
exceeds theoretical projections of how many genes comprise a minimal
genome such as Mushegian and Koonin's 256 genes shared by both H.
influenzae and M genitalium (2), and the 206 gene core of a minimal
bacterial gene set proposed by Gil et al (3). One of the surprises about
the present essential gene set is its inclusion of 108 hypothetical
proteins and proteins of unknown function.
[0058] These data suggest that a genome constructed to encode the 386
protein-coding and 43 structural RNA genes could sustain a viable
synthetic cell, which has been referred to hypothetically as a Mycoplasma
laboratorium (24). A variety of mechanisms can be used for preparing such
a viable synthetic cell. For example, the minimal gene set can be
introduced into a ghost cell, from which the resident genome has been
removed or disabled. In one embodiment, ribosomes, membranes and other
cellular components important for gene regulation, transcription,
translation, post-transcriptional modification, secretion, uptake of
nutrients or other substances, etc, are present in the ghost cell. In
another embodiment, one or more of these components is prepared
synthetically.
[0059] In one embodiment of the invention, the genes in the minimal gene
set, or a subset of those genes, are cloned into conventional vectors,
e.g. to form a library. The DNA to be cloned can be obtained from any
suitable source, including naturally occurring genes, genes previously
cloned into a different vector, or artificially synthesized genes. The
genes may be cloned by in vitro, synthetic procedures, such as those
disclosed in co-pending PCT application PCT/2006/16349, filed 1 May 2006,
"Amplification and Cloning of Single DNA Molecules Using Rolling Circle
Amplification," incorporated by reference herein in its entirety. For
example, synthetically prepared genes of the gene set may be amplified
and assembled to form a synthetic gene or genome. This can be performed
by diluting DNA molecules, such that each sample of diluted DNA contains,
on average, one molecule of DNA, in fragments of about 5 kb, for example,
and then converting to single stranded DNA circles, and then amplifying
the DNA circles using .PHI.29 polymerase.
[0060] As a library, the gene sets of the invention can be arranged in
any form, in single or multiple copies, and can be arranged in individual
oligonucleotides each having a section of one of the genes, one of the
genes, or more than one of the genes. These oligonucleotides can be
arranged as cassettes. The cassettes can be joined up to form larger gene
assemblies, including a minimal genome comprising or consisting of all
the genes of the gene set of the invention. The genes can be assembled by
a method such as that described in PCT International Patent Application
No. PCT/US06/31214, filed 11 Aug. 2006, "Method For In Vitro
Recombination Employing a 3' Exonuclease Activity, " incorporated by
reference herein in its entirety. PCT/US06/31214 describes methods of
joining cassettes of genes into larger assemblies, and can be used to
produce a single DNA molecule comprising the gene set of the invention.
In particular, that application describes an in vitro method, using
isolated proteins, for joining two or more double-stranded (ds) DNA
molecules of interest, wherein the distal region of the first DNA
molecule and the proximal region of the second DNA molecule of each pair
share a region of sequence identity, comprising (a) treating the DNA
molecules with an enzyme having an exonuclease activity, under conditions
effective to yield single-stranded overhanging portions of each DNA
molecule which contain a sufficient length of the region of sequence
homology to hybridize specifically to the region of sequence homology of
its pair; (b) incubating the treated DNA molecules of (a) under
conditions effective to achieve specific annealing of the single-stranded
overhanging portions; and (c) treating the incubated DNA molecules in (b)
under conditions effective to fill in remaining single-stranded gaps and
to seal the nicks thus formed, wherein the region of sequence identity
comprises at least 20 non-palindromic nucleotides (nt).
[0061] The DNA molecules of the library may have a size of any practical
length. The lower size limit for a dsDNA to circularize is about 200 base
pairs. Therefore, the total length of the joined fragments (including, in
some cases, the length of the vector) is preferably at least about 200 bp
in length. The DNAs can take the form of either a circle or a linear
molecule. The library may include from two to a very large number of DNA
molecules, which can be joined together. In general, at least about 10
fragments can be joined.
[0062] More particularly, the number of DNA molecules or cassettes that
may be joined to produce an end product, in one or several assembly
stages, may be at least or no greater than about 2, 3, 4, 6, 8, 10, 15,
20, 25, 50, 100, 200, 500, 1000, 5000, or 10,000 DNA molecules, for
example in the range of about 4 to about 100 molecules. The DNA molecules
or cassettes in a library of the invention may each have a starting size
in a range of at least or no greater than about 80 bs, 100 bs, 500 bs, 1
kb, 3 kb, 5 kb, 6 kb, 10 kb, 18 kb, 20 kb, 25 kb, 32 kb, 50 kb, 65 kb, 75
kb, 150 kb, 300 kb, 500 kb, 600 kb, or larger, for example in the range
of about 3 kb to about 100 kb. According to the invention, methods may be
used for assembly of about 100 cassettes of about 6 kb each, into a DNA
molecule of about 600 kb.
[0063] One embodiment of the invention is to join cassettes, such as 5-6
kb DNA molecules representing adjacent regions of a gene or genome
included in a gene set of the invention, to create combinatorial
assemblies. For example, it may be of interest to modify a bacterial
genome, such as a putative minimal genome or a minimal genome, so that
one or more of the genes is eliminated or mutated, and/or one or more
additional genes is added. Such modifications can be carried out by
dividing the genome into suitable cassettes, e.g. of about 5-6 kb, and
assembling a modified genome by substituting a cassette containing the
desired modification for the original cassette. Furthermore, if it is
desirable to introduce a variety of changes simultaneously (e.g. a
variety of modifications of a gene of interest, the addition of a variety
of alternative genes, the elimination of one or more genes, etc.), one
can assemble a large number of genomes simultaneously, using a variety of
cassettes corresponding to the various modifications, in combinatorial
assemblies. After the large number of modified sequences is assembled,
preferably in a high throughput manner, the properties of each of the
modified genomes can be tested to determine which modifications confer
desirable properties on the genome (or an organism comprising the
genome). This "mix and match" procedure produces a variety of test
genomes or organisms whose properties can be compared. The entire
procedure can be repeated as desired in a recursive fashion.
[0064] Methods of cloning, as well as many of the other molecular
biological methods used in conjunction with the present invention, are
discussed, e.g., in Sambrook, et al. (1989), Molecular Cloning, a
Laboratory Manual, Cold Harbor Laboratory Press, Cold Spring Harbor,
N.Y.; Ausubel et al. (1995). Current Protocols in Molecular Biology,
N.Y., John Wiley & Sons; Davis et al. (1986), Basic Methods in Molecular
Biology, Elseveir Sciences Publishing, Inc., New York; Hames et al.
(1985), Nucleic Acid Hybridization, IL Press; Dracopoli et al. Current
Protocols in Human Genetics, John Wiley & Sons, Inc.; and Coligan et al.
Current Protocols in Protein Science, John Wiley & Sons, Inc.
[0065] Another aspect of the invention is a set of genes or
polynucleotides on the invention which are in a free-living organism. The
organism may be in a dormant or resting state (e.g., lyophilized, stored
in a suitable solution, such as glycerol, or stored in culture medium),
or it may growing and/or replicating, for example in a rich culture
medium, such as SP4.
[0066] Another aspect of the invention is a set of polypeptides encoded
by a set of genes or polynucleotides of the invention. The polypeptides
may be, e.g., in a free-living organism.
[0067] Another aspect of the invention is a set of genes or
polynucleotides of the invention that are recorded on computer readable
media. As used herein, "computer readable media" refers to any medium
that can be read and accessed directly by a computer. Such media include,
but are not limited to: magnetic storage media, such as floppy discs,
hard disc storage medium, and magnetic tape; optical storage media such
as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of
these categories such as magnetic/optical storage media. The skilled
artisan will readily appreciate how any of the presently known computer
readable media can be used to create a manufacture comprising computer
readable medium having recorded thereon a polynucleotide or amino acid
sequence of the present invention.
[0068] As used herein, "recorded" refers to a process for storing
information on computer readable medium. The skilled artisan can readily
adopt any of the presently known methods for recording information on
computer readable medium to generate manufactures comprising the
nucleotide or amino acid sequence information of the present invention.
[0069] A variety of data storage structures are available to a skilled
artisan for creating a computer readable medium having recorded thereon a
set of nucleotide or amino acid sequences of the present invention. The
choice of the data storage structure will generally be based on the means
chosen to access the stored information. In addition, a variety of data
processor programs and formats can be used to store the nucleotide
sequence information of the present invention on computer readable
medium. The sequence information can be represented in a word processing
text file, formatted in commercially-available software such as
WordPerfect and Microsoft Word, or represented in the form of an ASCII
file, stored in a database application, such as DB2, Sybase, Oracle, or
the like. The skilled artisan can readily adapt any number of
dataprocessor structuring formats (e.g., text file or database) in order
to obtain computer readable medium having recorded thereon the nucleotide
sequence information of the present invention.
[0070] By providing a set of nucleotide or amino acid sequences of the
invention in computer readable form, the skilled artisan can routinely
access the sequence information for a variety of purposes. For example,
one skilled in the art can use the nucleotide or amino acid sequences of
the invention in computer readable form to compare the sequences with
orthologous sequences that can be substituted for the present sequences
in an alternative version of the minimal genome. Computer software is
publicly available which allows a skilled artisan to access sequence
information provided in a computer readable medium for analysis and
comparison to other sequences. A variety of known algorithms are
disclosed publicly and a variety of commercially available software for
conducting search means are and can be used in the computer-based systems
of the present invention. Examples of such software include, but are not
limited to, MacPattern (EMBL), BLASTN and BLASTX (NCBIA).
[0071] For example, software which implements the BLAST (Altschul et al.
(1990) J. Mol. Biol. 215:403-410) and BLAZE (Brutlag et al. (1993) Comp.
Chem. 17:203-207) search algorithms on a Sybase system can be used to
identify open reading frames (ORFs) of the sequences of the invention
which contain homology to ORFs or proteins from other libraries. Such
ORFs are protein encoding fragments and are useful in producing
commercially important proteins such as enzymes used in various reactions
and in the production of commercially useful metabolites.
[0072] In the foregoing and in the following example, all temperatures
are set forth in uncorrected degrees Celsius; and, unless otherwise
indicated, all parts and percentages are by weight.
EXAMPLES
I-Materials and Methods
[0073] A. Cells and plasmids. We obtained wild type M genitalium G37
(ATCC.RTM. Number: 33530.TM.) from the American Type Culture Collection
(Manassas, Va.). As part of this project we re-sequenced and re-annotated
the genome of this bacterium. The new M genitalium G37 sequence (Genbank
accession number CP000122) differed from the previous M genitalium (13)
genome sequence at 34 sites. Several genes previously listed as having
frameshifts were merged including MG 016, MG 017, and MG018 (DEAD
helicase) and MG419 and MG420 (DNA polymerase III gamma/tau subunit). Our
transposon mutagenesis vector was the plasmid pIVT-1, which contains the
Tn4001 transposon with a tetracycline resistance gene (tetM)(15), and was
a gift from Dr. Kevin Dybvig at the University of Alabama at Birmingham.
[0074] B. Transformation of M genitalium with Tn4001 by electroporation.
Confluent flasks of M genitalium cells were harvested by scraping into
electroporation buffer (EB) comprised of 8 mM HEPES+272 mM sucrose at pH
7.4. We washed and then resuspended the cells in a total volume of
200-300 .mu.l EB. On ice, 100 .mu.l cells were mixed with 30 .mu.g pIVT-1
plasmid DNA and transferred to a 2 mm chilled electroporation cuvette
(BioRad, Hercules, Calif.). We electroporated using 2500 V, 25 .mu.F, and
100.OMEGA.. After electroporation we resuspended the cells in 1 ml of
37.degree. C. SP4 medium and allowed the cells to recover for 2 hours at
37.degree. C. with 5% CO.sub.2. Aliquots of 200 .mu.l of cells were
spread onto SP4 agar plates containing 2 mg/l tetracycline hydrochloride
(VWR, Bridgeport, N.J.). The plates were incubated for 3-4 weeks at
37.degree. C. with 5% CO.sub.2 until colonies were visible. When colonies
were 3-4 weeks old, we transferred individual M genitalium colonies into
SP4 medium +7 mg/L tetracycline in 96 well plates. We incubated the
plates at 37.degree. C. with 5% CO.sub.2 until the SP4 in most of the
wells began to turn acidic and became yellow or orange (.about.4 days).
We froze those mutant stock cells at -80.degree. C.
[0075] C. Amplification of isolated colonies for DNA extraction. We
inoculated 4 ml SP4 containing 7 .mu.g/ml tetracycline in 6 well plates
with 20 .mu.l transposon mutant stock cells and incubated the plates at
37.degree. C. with 5% CO.sub.2 until the cells reached 100% confluence.
To extract genomic DNA from confluent cells, we scraped the cells and
then transferred the cell suspension to a tube for pelleting by
centrifugation. Thus any non-adherent cells were not lost. We washed the
cells in PBS (Mediatech, Herndon, Va.) and then resuspended them in a
mixture of 100 .mu.l PBS and 100 .mu.l of the chaotropic MTL buffer from
a Qiagen MagAttract DNA Mini M48 Kit (Qiagen, Valencia, Calif.). Tubes
were stored at -20.degree. C. until the genomic DNA could be extracted
using a Qiagen BioRobot M48 workstation (Qiagen).
[0076] D. Location of Tn4001 tet insertion sites by DNA sequencing from
M. genitalium genomic templates. Our 20 .mu.l sequencing reactions
contained .about.0.5 .mu.g of genomic DNA, 6.4 pmol of the 30 base
oligonucleotide GTACTCAATGAATTAGGTGGAAGACCGAGG (SEQ ID NO: 1) (Integrated
DNA Technologies, Coralville, Iowa). The primer binds in the tetM gene
103 basepairs from one of the transposon/genome junctions. Using BLAST we
located the insertion site on the M genitalium genome.
[0077] E. Quantitative PCR to determine colony homogeneity and genes
duplication. We designed quantitative PCR primers (Integrated DNA
Technologies) flanking transposon insertion sites using the default
conditions for the primer design software Primer Express 1.5 (Applied
Biosystems). Using quantitative PCR done on an Applied Biosystems 7700
Sequence Detection System, we determined the amounts of the target genes
lacking a Tn4001 insertion in genomic DNA prepared from mutant colonies
relative to a the amount of the those genes in wild type M genitalium .
Reactions were done in Eurogentec qPCR Mastermix Plus SYBR Green (San
Diego, Calif.). Genomic DNA concentrations were normalized after
determining their relative amounts using a TaqMan quantitative PCR
specific for the 16S rRNA gene that was done in Eurogentec qPCR Mastermix
Plus. We calculated the amounts of target genes lacking the transposon in
mutant genomic DNA preparations relative to the amounts in wild type
using the delta-delta Ct method (16).
II. Identification of a Minimal Gene Set
[0078] We sequenced across the transposon-genome junctions of our mutants
using a primer specific for Tn4001 tet. Presence of a transposon in the
central region of a gene of a viable bacterium indicated that gene was
disrupted and therefore non-essential (dispensable). We considered
transposon insertions disruptive only if they were after the first three
codons and before the 3'-most 20% of the coding sequence of a gene. Thus,
non-disruptive mutations resulting from transposon mediated duplication
of short sequences at the insertion site (18, 19), and potentially
inconsequential COOH-terminal insertions do not result in erroneous
determination of gene expendability. Without wishing to be bound by any
particular theory, it is suggested that these disruptions actually
occurred, even though theoretically, some genes might tolerate transposon
insertions, and we did not confirm the absence of the gene products. To
exclude the possibility that gene disruptions were the result of a
transposon insertion in one copy of a duplicated gene, we used PCR to
detect genes lacking the insertion. This showed us that almost all of our
colonies contained both disrupted and wild type versions of the genes
identified as having the Tn4001. Further analysis using quantitative PCR
showed most colonies were mixtures of two or more mutants, thus we
operationally refer to them and any DNA isolated from them as colonies
rather than clones. This cell clumping led us to isolate individual
mutants using filter cloning. To do this we forced cells through 0.22
.mu.m filters before plating to break up clumps of cells possibly
containing multiple different mutants. We used these cells to produce
subcolonies which we both sequenced and analyzed using quantitative PCR.
For each disrupted gene we subcloned at least one primary colony.
[0079] In total we analyzed 3,152 M genitalium transposon insertion
mutant primary colonies, and subcolonies to determine the locations of
Tn4001 tet inserts. For 75% of these we generated sequence data that
enabled us to map the transposon insertion sites. Colonies containing
multiple Tn4001 tet insertions cannot be characterized using this
approach. Only 62% of primary colonies generated useful sequence. This
was likely because of the tendency of mycoplasma cells to form persistent
cell aggregates leading to colonies containing mixtures of multiple
mutants that proved refractory to sequencing. For subcolonies the success
rate was 82%. Of the successfully sequenced subcolonies in 59% the
transposon insert was at a different site than in the parental primary
colony. The rate at which we identified mutants with previously unhit
insertion sites on the genome was higher for the primary colonies than
the subcolonies. However the rate of accumulation of new insertion sites
dropped after our first 600 colonies, indicating we were approaching
saturation mutagenesis of all non-lethal insertion sites (FIG. 1).
[0080] We mapped a total of 2293 different transposon insertion sites on
the genome (FIG. 2). Eighty-seven percent of the mutations were in
protein-coding genes. None of the 43 RNA encoding genes (for rRNA, tRNA,
or structural RNA) contained insertions. To address the question of which
M genitalium genes were not essential for growth in SP4 (17), a rich
laboratory medium, we used the following criteria to designate a gene
disruption. We considered transposon insertions disruptive if they were
after the first three codons and before the 3'-most 20% of the coding
sequence of a gene. Thus, non-disruptive mutations resulting from
transposon mediated duplication of short sequences at the insertion site
(18, 19), and potentially inconsequential COOH-terminal insertions do not
result in erroneous determination of gene expendability. Using these
criteria we identified a total of 101 dispensable M genitalium genes
(Table 2). In FIG. 1, it can be seen that new genes disrupted as a
function of primary colonies and subcolonies plateaus, suggesting that we
have or very nearly have disrupted all non-essential genes. Transposon
mutants in non-essential genes were able to form colonies on solid agar,
and isolated colonies were able to grow in liquid culture, both under
tetracycline selection.
[0081] We wanted to determine if any of our disrupted genes were in cells
bearing two copies of the gene. Unexpectedly, PCRs using primers flanking
the transposon insertion sites produced amplicons of the size expected
for wild type templates from all 5 colonies initially tested. End-stage
analysis of PCRs could not tell us if the wild type sequences we
amplified were the result of a low level of transposon jumping out of the
target gene, or if there was a gene duplication. To address this, for at
least one colony or subcolony for each disrupted gene we used
quantitative PCR to measure how many copies of contaminating wild type
versions of that gene there were in the sequenced DNA preps.
[0082] Analysis of the quantitative PCR results showed most colonies were
mixtures of multiple mutants. This was likely a consequence of our high
transformation efficiency and the tendency of mycoplasma cells to
aggregate. The direct genomic sequencing identified only the plurality
member of the population. To address this issue we adapted our mutant
isolation protocol to include one or two rounds of filter cloning.
Existing colonies of interest were filter subcloned. We isolated 10
subcolonies and the sites of their Tn4001 insertions were determined. We
took both rapidly growing colonies and M genitalium colonies that were
delayed in their appearance. Often only a minority of the subcolonies had
inserts in the same location as found with the parental colony. After
filter cloning we still found that almost every subcolony had some low
level of a wild type copy of the disrupted gene. This is likely the
result of Tn4001 jumping (20). After subcloning we were able to isolate
gene disruption mutant colonies for 100 of our 101 different disrupted M
genitalium genes that had less than 1% wild type sequence.
[0083] Several mutants manifested remarkable phenotypes. While many of
the mutants grew slowly, mutants in lactate/malate dehydrogenase (MG460),
and conserved hypothetical proteins MG414 and MG415 mutants had doubling
times up to 20% faster than wild type M genitalium (data not shown).
Cells with transposon insertions in the transketolase gene (MG066), which
encodes a membrane protein and pentose phosphate pathway enzyme, grew in
chains of clumped cells rather than in the monolayers characteristic of
wild type M genitalium . Other mutant cells grew in suspension rather
than adhering to plastic. Some cells would lyse when washed with PBS, and
thus had to be processed in either SP4 medium or 100% serum.
[0084] We isolated mutants with transposon insertions at some sites much
more frequently than others (FIG. 3). We found colonies with mutations at
hot spots in four genes: MG339 (recA), the fast growing MG414 and MG415
and MG428 (putative regulatory protein) comprised 31% of the total mutant
pool. There was a striking difference in the most frequently found
transposon insertion sites among primary colonies relative to the
subcolonies having different insertions sites than their parental
colonies (FIG. 3). We isolated 169 colonies and subcolonies having
different insertion sites than their parental colonies with Tn4001 tet
inserted at basepair 517, 751, which is in MG414. Only 5 (3%) of those
were primary colonies. Conversely, we isolated 209 colonies with inserts
in the 520,114 to 520,123 region, which is in MG415, and 56% of those
were in primary colonies. The MG414 mutants were probably due both to
rapid growth and to Tn4001 preferential jumping to that genome region,
whereas the high frequency and near equal distribution of MG415 primary
and subcolony transposon insertions may only be because those mutants
grow more rapidly than others.
III. Verification (or Modification) of the Minimal Gene Set
[0085] As noted above, at least 386 protein-coding genes and all of the
RNA genes are essential and could form a minimal set. However, it seems
unlikely that all of those "one-at-a time" dispensable genes could be
eliminated simultaneously. To determine a subset that can be
simultaneously deleted, a wild type chromosome is constructed
synthetically. The synthetic genome is constructed hierarchically from
chemically synthesized oligonucleotides. Subsets of the dispensable genes
are then removed. The synthetic natural chromosome and the reduced genome
are tested for viability by transplantation into cells from which the
resident chromosome has been removed. Rapid advances in gene synthesis
technology and efforts at developing genome transplantation methods allow
the confirmation that the M genitalium essential gene set described above
is a true minimal gene set, or provide a basis to modify that gene set.
REFERENCES
[0086] 1. Ferber, D. (2004) Science 303, 158-61. [0087] 2. Mushegian,
A. R. & Koonin, E. V. (1996) Proc Natl Acad Sci USA 93, 10268-73. [0088]
3. Gil, R., Silva, F. J., Pereto, J. & Moya, A. (2004) Microbiol Mol
Biol Rev 68, 518-37, table of contents. [0089] 4. Hutchison, C. A.,
Peterson, S. N., Gill, S. R., Cline, R. T., White, O., Fraser, C. M.,
Smith, H. O. & Venter, J. C. (1999) Science 286, 2165-9. [0090] 5.
Forsyth, R. A., Haselbeck, R. J., Ohlsen, K. L., Yamamoto, R. T., Xu, H.,
Trawick, J. D., Wall, D., Wang, L., Brown-Driver, V., Froelich, J. M. &
et al. (2002) Mol Microbiol 43, 1387-400. [0091] 6. Kobayashi, K.,
Ehrlich, S. D., Albertini, A., Amati, G., Andersen, K. K., Arnaud, M.,
Asai, K., Ashikaga, S., Aymerich, S., Bessieres, P. & et al. (2003) Proc
Natl Acad Sci USA 100, 4678-83. [0092] 7. Salama, N. R., Shepherd, B. &
Falkow, S. (2004) J Bacteriol 186, 7926-35. [0093] 8. Herring, C. D.,
Glasner, J. D. & Blattner, F. R. (2003) Gene 311, 153-63. [0094] 9.
Mori, H., Isono, K., Horiuchi, T. & Miki, T. (2000) Res Microbiol 151,
121-8. [0095] 10. Ji, Y., Zhang, B., Van, S. F., Horn, Warren, P.,
Woodnutt, G., Burnham, M. K. & Rosenberg, M. (2001) Science 293, 2266-9.
[0096] 11. Reich, K. A., Chovan, L. & Hessler, P. (1999) J Bacteriol
181, 4961-8. [0097] 12. Sassetti, C. M., Boyd, D. H. & Rubin, E. J.
(2001) Proc Natl Acad Sci USA 98, 12712-7. [0098] 13. Fraser, C. M.,
Gocayne, J. D., White, O., Adams, M. D., Clayton, R. A., Fleischmann, R.
D., Bult, C. J., Kerlavage, A. R., Sutton, G., Kelley, J. M. & et al.
(1995) Science 270, 397-403. [0099] 15. Dybvig, K., French, C. T. &
Voelker, L. L. (2000) J Bacteriol 182, 4343-7. [0100] 15a. Pour-El, I.,
Adams, C. and Minion, F. C. (2002). Plasmid 47, 129-37. [0101] 16.
Relative Quantitation of Gene Expression (1997) The Perkin-Elmer
Corporation., Foster City, Calif. [0102] 17. Tully, J. G., Rose, D. L.,
Whitcomb, R. F. & Wenzel, R. P. (1979) J Infect Dis 139, 478-82. [0103]
18. Dyke, K. G., Aubert, S. & el Solh, N. (1992) Plasmid 28, 235-46.
[0104] 19. Rice, L. B., Carias, L. L. & Marshall, S. H. (1995)
Antimicrob Agents Chemother 39, 1147-53. [0105] 20. Mahairas, G. G.,
Lyon, B. R., Skurray, R. A. & Pattee, P. A. (1989) J Bacteriol 171,
3968-72. [0106] 21. Cordwell, S. J., Basseal, D. J., Pollack, J. D. &
Humphery-Smith, I. (1997) Gene 195, 113-20. [0107] 22. Pollack, J. D.,
Myers, M. A., Dandekar, T. & Herrmann, R. (2002) Omics 6, 247-58. [0108]
23. Dhandayuthapani, S., Rasmussen, W. G. & Baseman, J. B. (1999) Proc
Natl Acad Sci USA 96, 5227-32. [0109] 24. Reich, K. A. (2000) Res
Microbiol 151, 319-24.
[0110] Tables:
TABLE-US-00005
TABLE 1
Paralogous gene families in bacteria used for gene essentiality studies.
Genes in Fraction of
Protein paralogous Average genes in Maximum
coding gene Paralogous family paralogous family
Species genes families families size gene families size
Mycoplasma genitalium 483 M. genitalium 29 12 2.4 6.0% 4
Bacillus subtilis 4106 1221 421 2.9 29.7% 55
Escherichia coli (K-12) 4254 1287 432 3.0 30.3% 52
Haemophilus influenzae 1709 190 73 2.6 11.1% 26
Helicobacter pylori 1566 192 71 2.7 12.3% 13
Mycobacterium bovis 3953 1294 336 3.9 32.7% 146
Pseudomonas 5566 2247 593 3.8 40.4% 114
aeruginosa
Staphylococcus aureus 2714 628 225 2.8 23.1% 44
[0111] We used a common definition for members of paralogous gene
families requiring they have 30% identity over 60% of the length of the
longer protein sequence (a single linkage clustering then defines the
families).
TABLE-US-00006
TABLE 2
Mycoplasma genitalium genes with Tn4001tet insertions that are disrupted.
Genes are
grouped by functional roles.
Locus Symbol Common name A B C
Biosynthesis of cofactors, prosthetic groups, and carriers
MG264 dephospho-CoA kinase x x
Cell envelope
MG040 lipoprotein, putative
MG067 lipoprotein, putative x
MG147 Lipoprotein, putative
MG149 lipoprotein, putative
MG185 lipoprotein, putative
MG260 lipoprotein, putative
Cellular processes
MG238 tig trigger factor x
DNA metabolism
MG009 deoxyribonuclease, TatD family, putative x x
MG213 scpA segregation and condensation protein A
MG214 segregation and condensation protein B x
MG244 UvrD/REP helicase x x
MG262.1 mutM formamidopyrimidine-DNA glycosylase x
MG298 smc chromosome segregation protein SMC x x
MG315 DNA polymerase III, delta subunit, putative x x
MG339 recA recA protein (recombinase A) x
MG352 recU recombination protein U
MG358 ruvA Holliday junction DNA helicase x
MG359 ruvB Holliday junction DNA helicase RuvB x
MG438 type I restriction modification DNA specificity domain protein x
Energy metabolism
MG063 fruK 1-phosphofructokinase, putative x x
MG066 tkt transketolase x x x
MG112 rpe ribulose-phosphate 3-epimerase x x
MG271 lpdA dihydrolipoamide dehydrogenase x
MG398 atpC ATP synthase F1, epsilon subunit x x
MG460 ldh L-lactate dehydrogenase/malate dehydrogenase x x
Fatty acid and phospholipid metabolism
MG039 FAD-dependent glycerol-3-phosphate dehydrogenase, putative x
MG293 glycerophosphoryl diester phosphodiesterase family protein x
MG385 glycerophosphoryl diester phosphodiesterase family protein x
MG437 cdsA phosphatidate cytidylyltransferase x x
Hypothetical proteins
MG011 conserved hypothetical protein x
MG032 conserved hypothetical protein
MG096 conserved hypothetical protein
MG103 conserved hypothetical protein
MG116 conserved hypothetical protein
MG131 conserved hypothetical protein, authentic framehsift
MG134 conserved hypothetical protein
MG140 conserved hypothetical protein x
MG149.1 conserved hypothetical protein
MG220 conserved hypothetical protein
MG237 conserved hypothetical protein
MG248 conserved hypothetical protein
MG255 conserved hypothetical protein
MG255.1 conserved hypothetical protein
MG256 conserved hypothetical protein
MG268 conserved hypothetical protein x
MG269 conserved hypothetical protein
MG280 conserved hypothetical protein
MG281 conserved hypothetical protein
MG284 conserved hypothetical protein
MG285 conserved hypothetical protein
MG286 conserved hypothetical protein
MG328 conserved hypothetical protein
MG343 conserved hypothetical protein
MG397 conserved hypothetical protein
MG414 conserved hypothetical protein
MG415 conserved hypothetical protein
MG449 conserved hypothetical protein, authentic frameshift x
MG456 conserved hypothetical protein
Protein fate
MG002 DnaJ domain protein x
MG183 oligoendopeptidase F x
MG210 signal peptidase II x
MG238 tig trigger factor x
MG355 clpB ATP-dependent Clp protease, ATPase subunit x
MG408 msrA methionine-S-sulfoxide reductase x
Protein synthesis
MG012 alpha-L-glutamate ligases, RimK family, putative x
MG110 rsgA ribosome small subunit-dependent GTPase A
MG252 RNA methyltransferase, TrmH family, group 3 x
MG346 RNA methyltransferase, TrmH family, group 2 x x x
MG370 pseudouridine synthase, RluA family x
MG463 dimethyladenosine transferase x x
Purines, pyrimidines, nucleosides, and nucleotides
MG051 pdp pyrimidine-nucleoside phosphorylase x
MG227 thyA thymidylate synthase x x
Regulatory functions
MG428 LuxR bacterial regulatory protein, putative
Transcription
MG367 rnc ribonuclease III x x x
Transport and binding proteins
MG033 glpF glycerol uptake facilitator x
MG061 Mycoplasma MFS transporter x
MG062 fruA PTS system, fructose-specific IIABC component x
MG121 ABC transporter, permease protein x
MG226 amino acid-polyamine-organocation (APC) permease family protein x
MG289 phosphonate ABC transporter, substrate binding protein (P37),
putative
MG290 phosphonate ABC transporter, ATP-binding protein, putative
MG291 phosphonate ABC transporter, permease protein (P69), putative
MG294 major facilitator superfamily protein, putative x
MG390 ABC transporter, ATP-binding/permease protein
MG410 pstB phosphate ABC transporter, ATP-binding protein x
MG411 phosphate ABC transporter, permease protein PstA x
MG412 phosphate ABC transporter, substrate-binding protein
Unknown function
MG010 DNA primase-related protein x
MG018 helicase SNF2 family, putative x
M0024 ychF GTP-binding protein YchF x x
MG056 tetrapyrrole (corrin/porphyrin) methylase protein x x
MG115 competence/damage-inducible protein CinA domain protein
MG138 lepA GTP-binding protein LepA x x
MG207 Ser/Thr protein phosphatase family protein
MG279 expressed protein of unknown function
MG316 ComEC/Rec2-related protein x
MG360 ImpB/MucB/SamB family protein x
MG380 methyltransferase GidB X
MG454 OsmC-like protein
All information is based on the M genitalium genome sequence and
annotation reported herein. Genes are grouped by main biological roles.
The columns are as follows:
[0112] M genitalium gene locus
[0113] Gene symbol
[0114] Gene common name [0115] A. Orthologous genes essential in
Bacillus. subtilis(1). [0116] B. In theoretical minimal 256 gene set
defined by Mushegian and Koonin as orthologous genes present in M
genitalium and H. influenzae(2). [0117] C. In theoretical 206 gene core
of a minimal genome set defined by Gil et al (3).
REFERENCES
[0117] [0118] 1 Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati,
G., Andersen, K. K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S.,
Bessieres, P., et al. (2003) Proc Natl Acad Sci US A 100, 4678-83.
[0119] 2. Mushegian, A. R. & Koonin, E. V. (1996) Proc Natl Acad Sci USA
93, 10268-73.
[0120] 3. Gil, R., Silva, F. J., Pereto, J. & Moya, A. (2004) Microbiol
Mol Biol Rev 68, 518-37, table of contents.
TABLE-US-00007
TABLE 3
Mycoplasma genitalium protein coding genes that were not disrupted in this
study.
Genes are grouped by functional roles.
Locus Symbol Common name A B C
Biosynthesis of cofactors, prosthetic groups, and carriers
MG037 nicotinate phosphoribosyltransferase (NAPRTase) family x x
MG128 inorganic polyphosphate/ATP-NAD kinase, probable x x
MG145 ribF riboflavin biosynthesis protein RibF x x
MG228 dhfR dihydrofolate reductase x x x
MG240 nicotinamide-nucleotide adenylyltransferase/conserved hypothetical
x
protein
MG383 NH(3)-dependent NAD+ synthetase, putative x x
MG394 glyA serine hydroxymethyltransferase x x x
Cell envelope
MG025 glycosyl transferase, group 2 family protein x
MG060 glycosyl transferase, group 2 family protein x
MG068 lipoprotein, putative x
MG095 lipoprotein, putative
MG133 membrane protein, putative
MG191 mgpA MgPa adhesin x
MG192 p110 P110 protein x
MG217 proline-rich P65 protein
MG218 hmw2 HMW2 cytadherence accessory protein
MG247 membrane protein, putative x
MG277 membrane protein, putative
MG306 membrane protein, putative
MG307 lipoprotein, putative
MG309 lipoprotein, putative
MG312 hmw1 HMW1 cytadherence accessory protein x
MG313 membrane protein, putative x
MG317 hmw3 HMW3 cytadherence accessory protein x
MG318 p32 P32 adhesin x
MG320 membrane protein, putative
MG321 lipoprotein, putative
MG335.2 glycosyl transferase, group 2 family protein
MG338 lipoprotein, putative
MG348 lipoprotein, putative
MG350.1 membrane protein, putative
MG386 p200 P200 protein x
MG395 lipoprotein, putative
MG432 membrane protein, putative
MG439 lipoprotein, putative
MG440 lipoprotein, putative
MG443 membrane protein, putative
MG447 membrane protein, putative
MG453 galU UTP-glucose-1-phosphate uridylyltransferase x
MG464 membrane protein, putative
Cell/organism defense
MG075 116 kDa surface antigen
Cellular processes
MG224 ftsZ cell division protein FtsZ x x x
MG278 relA GTP pyrophosphokinase x
MG335 GTP-binding protein engB, putative x
MG384 obg GTPase1 Obg x x
MG387 era GTP-binding protein Era x x
MG457 ftsH ATP-dependent metalloprotease FtsH x x
Central intermediary metabolism
MG013 folD methylenetetrahydrofolate
dehydrogenase/methylenetetrahydrofolate x x
cyclohydrolase
MG047 metK S-adenosylmethionine synthetase x x x
MG245 5-formyltetrahydrofolate cyclo-ligase, putative x
MG351 ppa inorganic pyrophosphatase x x
DNA metabolism
MG001 dnaN DNA polymerase III, beta subunit x x x
MG003 gyrB DNA gyrase, B subunit x x x
MG004 gyrA DNA gyrase, A subunit x x x
MG007 DNA polymerase III delta prime subunit, putative x x x
MG031 polC DNA polymerase III, alpha subunit, Gram-positive type x x x
MG073 uvrB excinuclease ABC, B subunit x
MG091 single-strand binding protein family x x x
MG094 dnaB replicative DNA helicase x x x
MG097 uracil-DNA glycosylase, putative x x
MG122 topA DNA topoisomerase I x x
MG184 adenine-specific DNA modification methylase x
MG186 Staphylococcal nuclease homologue, putative
MG199 rnhC ribonuclease HIII
MG203 parE DNA topoisomerase IV, B subunit x x
MG204 parC DNA topoisomerase IV, A subunit x x
MG206 excinuclease ABC, C subunit x
MG235 apurinic endonuclease (APN1) x x
MG250 DNA primase x x x
MG254 ligA DNA ligase, NAD-dependent x x x
MG261 polC-2 DNA polymerase III, alpha subunit x x
MG262 5'-3' exonuclease, putative x x
MG353 DNA-binding protein HU, putative x x
MG419 DNA polymerase III, subunit gamma and tau
MG421 uvrA excinuclease ABC, A subunit x
MG469 chromosomal replication initiator protein DnaA x x
Energy metabolism
MG023 fba fructose-1,6-bisphosphate aldolase, class II x x x
MG038 glpK glycerol kinase x
MG050 deoC deoxyribose-phosphate aldolase x
MG053 phosphoglucomutase/phosphomannomutase, putative x
MG102 trxB thioredoxin-disulfide reductase x x x
MG111 pgi glucose-6-phosphate isomerase x x
MG118 galE UDP-glucose 4-epimerase x
MG124 trx thioredoxin x x
MG215 pfk 6-phosphofructokinase x x x
MG216 pyk pyruvate kinase x x
MG272 pdhC dihydrolipoamide acetyltransferase x
MG273 pdhB pyruvate dehydrogenase component E1, beta subunit x
MG274 pdhA pyruvate dehydrogenase component E1, alpha subunit x
MG275 nox NADH oxidase x
MG299 pta phosphate acetyltransferase x
MG300 pgk phosphoglycerate kinase x x x
MG301 gap glyceraldehyde-3-phosphate dehydrogenase, type I x x
MG357 ackA acetate kinase x
MG396 rpiB ribose 5-phosphate isomerase B x x
MG399 atpD ATP synthase F1, beta subunit x x
MG400 atpG ATP synthase F1, gamma subunit x x
MG401 atpA ATP synthase F1, alpha subunit x x
MG402 atpH ATP synthase F1, delta subunit x x
MG403 atpF ATP synthase F0, B subunit x x
MG404 atpE ATP synthase F0, C subunit x x
M0405 atpB ATP synthase F0, A subunit x x
MG407 eno enolase x x x
MG430 gpmI 2,3-bisphosphoglycerate-independent phosphoglycerate mutase x x
x
MG431 tpiA triosephosphate isomerase x x x
Fatty acid and phospholipid metabolism
MG114 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
x x
MG211.1 acpS holo-(acyl-carrier-protein) synthase x
MG212 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative x x
MG287 acyl carrier protein, putative x x
MG333 acyl carrier protein phosphodiesterase, putative x x
MG356 choline/ethanolamine kinase, putative
MG368 plsX fatty acid/phospholipid synthesis protein PlsX x
Hypothetical proteins
MG028 conserved hypothetical protein
MG055.2 conserved hypothetical protein
MG074 conserved hypothetical protein
MG076 conserved hypothetical protein
MG101 conserved hypothetical protein
MG105 conserved hypothetical protein
MG117 conserved hypothetical protein
MG123 conserved hypothetical protein
MG129 conserved hypothetical protein
MG141.1 conserved hypothetical protein
MG144 conserved hypothetical protein
MG146 conserved hypothetical protein x x
MG148 conserved hypothetical protein
MG202 conserved hypothetical protein
MG210.1 conserved hypothetical protein
MG211 conserved hypothetical protein
MG218.1 conserved hypothetical protein
MG219 Hypothetical protein
MG223 conserved hypothetical protein
MG233 conserved hypothetical protein
MG241 conserved hypothetical protein
MG243 conserved hypothetical protein
MG267 conserved hypothetical protein
MG291.1 conserved hypothetical protein x
MG296 conserved hypothetical protein
MG314 conserved hypothetical protein x
MG319 conserved hypothetical protein
MG323.1 conserved hypothetical protein
MG331 conserved hypothetical protein
MG335.1 conserved hypothetical protein
MG337 conserved hypothetical protein
MG349 conserved hypothetical protein
MG354 conserved hypothetical protein
MG366 conserved hypothetical protein
MG373 conserved hypothetical protein
MG374 conserved hypothetical protein
MG376 conserved hypothetical protein
MG377 conserved hypothetical protein
MG381 conserved hypothetical protein
MG384.1 conserved hypothetical protein
MG389 conserved hypothetical protein
MG406 conserved hypothetical protein x
MG422 conserved hypothetical protein
MG423 conserved hypothetical protein x
MG441 conserved hypothetical protein
MG442 GTP-binding conserved hypothetical protein
MG459 conserved hypothetical protein
Protein fate
MG019 dnaJ chaperone protein DnaJ x x
MG020 pip proline iminopeptidase x
MG046 metalloendopeptidase, putative, glycoprotease family x x
MG048 ffh signal recognition particle protein x x x
MG055 preprotein translocase, SecE subunit x x
MG072 secA preprotein translocase, SecA subunit x x x
MG086 prolipoprotein diacylglyceryl transferase x
MG103.1 preprotein translocase, SecG subunit
MG106 def peptide deformylase x
MG109 serine/threonine protein kinase, putative x
MG170 secY preprotein translocase, SecY subunit x x x
MG172 map methionine aminopeptidase, type I x x x
MG200 DnaJ domain protein x
MG201 co-chaperone GrpE x x
MG208 glycoprotease family protein
MG239 lon ATP-dependent protease La x x
MG270 lipoyltransferase/lipoate-protein ligase, putative x
MG297 ftsY signal recognition particle-docking protein FtsY x x x
MG305 dnaK chaperone protein DnaK x x
MG324 metallopeptidase family M24 aminopeptidase x
MG391 cytosol aminopeptidase x x
MG392 groL chaperonin GroEL x x x
MG393 groES chaperonin, 10 kDa (GroES) x x x
MG448 msrB methionine-R-sulfoxide reductase x
Protein synthesis
MG005 serS seryl-tRNA synthetase x x x
MG008 tRNA modification GTPase TrmE x x
MG021 metG methionyl-tRNA synthetase x x x
MG026 efp translation elongation factor P x x
MG035 hisS histidyl-tRNA synthetase x x x
MG036 aspS aspartyl-tRNA synthetase x x x
MG055.1 rpmG-2 ribosomal protein L33 type 2
MG059 smpB SsrA-binding protein x x
MG070 rpsB ribosomal protein S2 x x x
MG081 rplk ribosomal protein L11 x x x
MG082 rplA ribosomal protein L1 x x x
MG083 pth peptidyl-tRNA hydrolase x x x
MG084 tRNA(Ile)-lysidine synthetase x
MG087 rpsL ribosomal protein S12 x x x
MG088 rpsG ribosomal protein S7 x x x
MG089 fusA translation elongation factor G x x x
MG090 ribosomal protein S6 x x x
MG092 rpsR ribosomal protein S18 x x x
MG093 ribosomal protein L9 x x x
MG098 glutamyl-tRNA(Gln) and/or aspartyl-tRNA(Asn) amidotransferase, C x
subunit
MG099 glutamyl-tRNA(Gln) and/or aspartyl-tRNA(Asn) amidotransferase, A x
x
subunit
MG100 gatB glutamyl-tRNA(Gln) and/or aspartyl-tRNA(Asn) amidotransferase,
B x x
subunit
MG113 asnS asparaginyl-tRNA synthetase x x x
MG126 trpS tryptophanyl-tRNA synthetase x x x
MG136 lysS lysyl-tRNA synthetase x x x
MG142 infB translation initiation factor IF-2 x x x
MG150 rpsJ ribosomal protein S10 x x x
MG151 rplC ribosomal protein L3 x x x
MG152 rplD ribosomal protein L4/L1 family x x x
MG153 rplW ribosomal protein L23 x x x
MG154 rplB ribosomal protein L2 x x x
MG155 rpsS ribosomal protein S19 x x x
MG156 rplV ribosomal protein L22 x x x
MG157 rpsC ribosomal protein S3 x x x
MG158 rplP ribosomal protein L16 x x x
MG159 rpmC ribosomal protein L29 x x x
MG160 rpsQ ribosomal protein S17 x x x
MG161 rplN ribosomal protein L14 x x x
MG162 rplX ribosomal protein L24 x x x
MG163 rplE ribosomal protein L5 x x x
MG164 rpsN ribosomal protein S14 x x x
MG165 rpsH ribosomal protein S8 x x x
MG166 rplF ribosomal protein L6 x x x
MG167 rplR ribosomal protein L18 x x x
MG168 rpsE ribosomal protein S5 x x x
MG169 rplO ribosomal protein L15 x x x
MG173 infA translation initiation factor IF-1 x x x
MG174 rpmJ ribosomal protein L36 x x x
MG175 rpsM ribosomal protein S13 x x x
MG176 rpsK ribosomal protein S11 x x x
MG178 rplQ ribosomal protein L17 x x x
MG182 tRNA pseudouridine synthase A x
MG194 pheS phenylalanyl-tRNA synthetase, alpha subunit x x x
MG195 phenylalanyl-tRNA synthetase, beta subunit x x x
MG196 infC translation initiation factor IF-3 x x x
MG197 rpmI ribosomal protein L35 x x x
MG198 rplT ribosomal protein L20 x x x
MG209 pseudouridine synthase, RluA family x
MG210.2 rpsU ribosomal protein S21
MG232 rplU ribosomal protein L21 x x x
MG234 rpmA ribosomal protein L27 x x x
MG251 glyS glycyl-tRNA synthetase x x x
MG253 cysS cysteinyl-tRNA synthetase x x x
MG257 rpmE ribosomal protein L31 x x x
MG258 prfA peptide chain release factor 1 x x x
MG266 leuS leucyl-tRNA synthetase x x x
MG283 proS prolyl-tRNA synthetase x x x
MG292 alaS alanyl-tRNA synthetase x x x
MG295 trmU tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase x
x x
MG311 rpsD ribosomal protein S4 x x
MG325 rpmG ribosomal protein L33 x x x
MG334 valS valyl-tRNA synthetase x x x
MG345 ileS isoleucyl-tRNA synthetase x x x
MG347 tRNA (guanine-N(7)-)-methyltransferase x
MG361 ribosomal protein L10 x x x
MG362 rplL ribosomal protein L7/L12 x x x
MG363 rpmF ribosomal protein L32 x x x
MG363.1 ribosomal protein S20 x x x
MG365 methionyl-tRNA formyltransferase x x
MG372 thiamine biosynthesis/tRNA modification protein ThiI
MG375 thrS threonyl-tRNA synthetase x x
MG378 argS arginyl-tRNA synthetase x x x
MG417 rpsI ribosomal protein S9 x x x
MG418 rplM ribosomal protein L13 x x x
MG424 rpsO ribosomal protein S15 x x x
MG426 rpmB ribosomal protein L28 x x x
MG433 tsf translation elongation factor Ts x x x
MG435 frr ribosome recycling factor x x x
MG444 rpls ribosomal protein L19 x x x
MG445 trmD tRNA (guanine-N1)-methyltransferase x x
MG446 rpsP ribosomal protein S16 x x x
MG451 tuf translation elongation factor Tu x x x
MG455 tyrS tyrosyl-tRNA synthetase x x x
MG462 gltX glutamyl-tRNA synthetase x x x
MG466 rpL34 ribosomal protein L34 x x x
Purines, pyrimidines, nucleosides, and nucleotides
MG006 tmk thymidylate kinase x x x
MG030 upp uracil phosphoribosyltransferase x x
MG034 tdk thymidine kinase x
MG049 deoD purine nucleoside phosphorylase x
MG052 cytidine deaminase x
MG058 prs ribose-phosphate pyrophosphokinase x x
MG107 gmk guanylate kinase x x x
MG171 adk adenylate kinase x x x
MG229 nrdF ribonucleoside-diphosphate reductase, beta chain x x x
MG230 nrdI nrdI protein x
MG231 nrdE ribonucleoside-diphosphate reductase, alpha chain x x x
MG276 apt adenine phosphoribosyltransferase x
MG330 cmk cytidylate kinase x x
MG382 udk uridine kinase x
MG434 pyrH uridylate kinase x
MG458 hpt hypoxanthine phosphoribosyltransferase x x x
Regulatory functions
MG127 Spx subfamily protein x
MG205 heat-inducible transcription repressor HrcA, putative
Transcription
MG022 DNA-directed RNA polymerase, delta subunit x
MG027 nusB transcription termination/antitermination protein NusB
MG054 transcription antitermination protein NusG, putative x x
MG104 ribonuclease R x
MG141 nusA transcription termination factor NusA x x x
MG143 rbfA ribosome-binding factor A x x
MG177 rpoA DNA-directed RNA polymerase, alpha subunit x x x
MG249 rpoD RNA polymerase sigma factor RpoD x x
MG282 greA transcription elongation factor GreA x x
MG340 rpoC DNA-directed RNA polymerase, beta' subunit x x x
MG341 rpoB DNA-directed RNA polymerase, beta subunit x x x
MG465 rnpA ribonuclease P protein component x x x
Transport and binding proteins
MG014 ABC transporter, ATP-binding/permease protein x
MG015 ABC transporter, ATP-binding/permease protein x
MG041 phosphocarrier protein HPr x x
MG042 spermidine/putrescine ABC transporter, ATP-binding protein, x
putative
MG043 spermidine/putrescine ABC transporter, permease protein, putative x
MG044 spermidine/putrescine ABC transporter, permease protein, putative x
MG045 ABC transporter, spermidine/putrescine binding protein, putative x
MG064 ABC transporter, permease protein, putative
MG065 ABC transporter, ATP-binding protein x
MG069 ptsG PTS system, glucose-specific IIABC component x x
MG071 ATPase, P-type (transporting), HAD superfamily, subfamily IC x
MG077 oligopeptide ABC transporter, permease protein (OppB) x
MG078 oligopeptide ABC transporter, permease protein (OppC) x
MG079 oppD oligopeptide ABC transporter, ATP-binding protein x
MG080 oppF oligopeptide ABC transporter, ATP-binding protein x
MG085 hprK HPr(Ser) kinase/phosphatase
MG119 ABC transporter, ATP-binding protein x
MG120 ABC transporter, permease protein x
MG179 metal ion ABC transporter, ATP-binding protein, putative
MG180 metal ion ABC transporter ATP-binding protein, putative x
MG181 metal ion ABC transporter, permease protein
MG187 ABC transporter, ATP-binding protein x
MG188 ABC transporter, permease protein x
MG189 ABC transporter, permease protein x
MG225 amino acid-polyamine-organocation (APC) permease family protein x
MG302 metal ion ABC transporter, permease protein, putative x
MG303 metal ion ABC transporter, ATP-binding protein, putative x
MG304 metal ion ABC transporter, ATP binding protein, putative
MG322 potassium uptake protein, TrkH family, putative x
MG323 potassium uptake protein, TrkA family x
MG409 phosphate transport system regulatory protein PhoU, putative x
MG429 ptsI phosphoenolpyruvate-protein phosphotransferase x x
MG467 ABC transporter, ATP-binding protein x
MG468 ABC transporter, permease protein
MG468.1 ABC transporter, ATP-binding protein
Unknown function
MG029 DJ-1/PfpI family protein
MG057 small primase-like protein
MG108 protein phosphatase 2C, putative x
MG125 Cof-like hydrolase, putative x
MG130 uncharacterized domain HDIG
MG132 HIT domain protein x
MG137 UDP-galactopyranose mutase
MG139 metallo-beta-lactamase superfamily protein x
MG190 phosphoesterase, DHH subfamily 1 x
MG221 mraZ mraZ protein x
MG222 S-adenosyl-methyltransferase MraW x x
MG236 expressed protein of unknown function
MG242 expressed protein of unknown function
MG246 Ser/Thr protein phosphatase family protein
MG259 modification methylase, HemK family x x
MG263 Cof-like hydrolase
MG265 Cof-like hydrolase x
MG288 expressed protein of unknown function
MG308 ATP-dependent RNA helicase, DEAD/DEAH box family x
MG310 hydrolase, alpha/beta fold family
MG326 degV family protein x
MG327 hydrolase, alpha/beta fold family
MG329 engA GTP-binding protein engA x
MG332 expressed protein of unknown function x
MG336 aminotransferase, class V x x x
MG342 NADPH-dependent FMN reductase domain protein
MG344 hydrolase, alpha/beta fold family x
MG350 expressed protein of unknown function
MG364 expressed protein of unknown function
MG369 DAK2 phosphatase domain protein
MG371 DHH family protein
MG379 gidA glucose-inhibited division protein A x x
MG388 expressed protein of unknown function x
MG425 ATP-dependent RNA helicase, DEAD/DEAH box family x x
MG427 OsmC-like protein
MG450 degV family protein
MG461 HD domain protein x
MG470 CobQ/CobB/MinD/ParA nucleotide binding domain x
[0121]
TABLE-US-00008
RNA Gene Name 5' End 3' End
tRNA-Ala-1 15369 15294
tRNA-Ile-1 15451 15375
tRNA-Ser-1 70481 70393
Mg16SA 171525
Mg23SA 174465
Mg5SA 174793
tRNA-Thr-1 240286 240213
tRNA-Cys-1 257158 257234
tRNA-Pro-1 257269 257345
tRNA-Met-1 257349 257425
tRNA-Met-2 257445 257521
tRNA-Ser-2 257559 257650
tRNA-Met-3 257664 257740
tRNA-Asp-1 257742 257815
tRNA-Phe-1 257818 257893
tRNA-Arg-1 266423 266499
tRNA-Gly-1 304965 304892
tRNA-Arg-2 306617 306691
tRNA-Trp-1 306740 306813
tRNA-Arg-3 315377 315301
Mg_srp01 326006 325924
Mg_hsRNA01 331215 331034
tRNA-Gly-2 343957 343884
tRNA-Leu-1 344050 343965
tRNA-Lys-1 344125 344051
tRNA-Gln-1 344246 344172
tRNA-Tyr-1 344337 344251
tRNA-SeC-1 349128 349202
tRNA-Ser-3 399868 399958
tRNA-Ser-4 399960 400048
tRNA-Leu-2 403218 403134
tRNA-Lys-2 403299 403224
tRNA-Thr-2 403381 403306
tRNA-Val-1 403458 403383
tRNA-Thr-3 403541 403467
tRNA-Glu-1 403620 403544
tRNA-Asn-1 403701 403627
Mg_rnpB01 406519 406142
MgtmRNA1 406542 406929
tRNA-His-1 445078 445153
tRNA-Leu-3 446265 446178
tRNA-Leu-4 448783 448864
tRNA-Arg-4 480315 480240
All information is based on the M genitalium genome sequence and
annotation reported herein. Genes are grouped by main biological roles.
The columns for the protein coding genes are as follows:
[0122] M genitalium gene locus
[0123] Gene symbol
[0124] Gene common name [0125] A. Orthologous genes essential in
Bacillus. subtilis(1). [0126] B. In theoretical minimal 256 gene set
defined by Mushegian and Koonin as orthologous genes present in M
genitalium and H. influenzae(2). [0127] C. In theoretical 206 gene core
of a minimal genome set defined by Gil et al (3).
REFERENCES
[0127] [0128] 1 Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati,
G., Andersen, K. K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S.,
Bessieres, P., et al. (2003) Proc Natl Acad Sci USA 100, 4678-83. [0129]
2. Mushegian, A. R. & Koonin, E. V. (1996) Proc Natl Acad Sci USA 93,
10268-73.
[0130] 3. Gil, R., Silva, F. J., Pereto, J. & Moya, A. (2004) Microbiol
Mol Biol Rev 68, 518-37, table of contents.
TABLE-US-00009
TABLE 4
Mycoplasma genitalium genes with Tn4001tet insertions that were not
reported as being
disrupted (dispensable) in the 1999 study by Hutchison et al., but which
have been shown to be
dispensable in the present study. Genes are grouped by functional roles.
Gene
Locus Symbol Common Name A B C
Cell envelope
MG147 membrane protein, putative (disrupted 7/06 using different tn40001
system)
DNA metabolism
MG214 segregation and condensation protein B x
MG262.1 mutM formamidopyrimidine-DNA glycosylase x
MG298 smc chromosome segregation protein SMC x x
MG315 DNA polymerase III, delta subunit, putative x x
MG358 ruvA Holliday junction DNA helicase x
MG359 ruvB Holliday junction DNA helicase RuvB x
Energy metabolism
MG063 fruK 1-phosphofructokinase, putative x x
MG066 tkt transketolase x x x
MG112 rpe ribulose-phosphate 3-epimerase x x
MG271 lpdA dihydrolipoamide dehydrogenase x
MG398 atpC ATP synthase F1, epsilon subunit x x
MG460 ldh L-lactate dehydrogenase/malate dehydrogenase x x
Fatty acid and phospholipid metabolism
MG437 cdsA phosphatidate cytidylyltransferase x x
Hypothetical proteins
MG134 conserved hypothetical protein
MG149.1 conserved hypothetical protein
MG220 conserved hypothetical protein
MG248 conserved hypothetical protein
MG397 conserved hypothetical protein
MG456 conserved hypothetical protein
Protein fate
MG210 signal peptidase II x
MG238 tig trigger factor x
Protein synthesis
MG012 alpha-L-glutamate ligases, RimK family, putative x
MG463 dimethyladenosine transferase x x
Transcription
MG367 rnc ribonuclease III x x x
Transport and binding proteins
MG061 Mycoplasma MFS transporter x
MG121 ABC transporter, permease protein x
MG289 phosphonate ABC transporter, substrate binding protein (P37),
putative
MG290 phosphonate ABC transporter, ATP-binding protein, putative
Unknown function
MG056 tetrapyrrole (corrin/porphyrin) methylase protein x x
MG115 competence/damage-inducible protein CinA domain protein
MG138 lepA GTP-binding protein LepA x x
MG360 ImpB/MucB/SamB family protein x
MG454 OsmC-like protein
All information is based on the new M genitalium genome sequence and
annotation reported here. Genes are grouped by main biological roles. The
columns are as follows:
[0131] M genitalium gene locus
[0132] Gene symbol
[0133] Gene common name [0134] A. Orthologous genes essential in
Bacillus. subtilis(1). [0135] B. In theoretical minimal 256 gene set
defined by Mushegian and Koonin as orthologous genes present in M
genitalium and H. influenzae(2). [0136] C. In theoretical 206 gene core
of a minimal genome set defined by Gil et al (3).
REFERENCES
[0136] [0137] 1 Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati,
G., Andersen, K. K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S.,
Bessieres, P., et al. (2003) Proc Natl Acad Sci USA 100, 4678-83. [0138]
2. Mushegian, A. R. & Koonin, E. V. (1996) Proc Natl Acad Sci USA 93,
10268-73.
[0139] 3. Gil, R., Silva, F. J., Pereto, J. & Moya, A. (2004) Microbiol
Mol Biol Rev 68, 518-37, table of contents.
TABLE-US-00010
TABLE 5
Mycoplasma genitalium genes with Tn4001tet insertions that were not
reported as being
required in the 1999 study by Hutchison et al., but which are shown to be
required in the present
study. Genes are grouped by functional roles.
Gene
Locus Symbol Common Name A B C D
Biosynthesis of cofactors, prosthetic groups, and carriers
MG394 glyA serine hydroxymethyltransferase x x x x
Cell envelope
MG068 lipoprotein, putative p x
MG218 hmw2 HMW2 cytadherence accessory protein p
MG306 membrane protein, putative p
MG307 lipoprotein, putative p
MG320 membrane protein, putative p
MG443 membrane protein, putative p
MG025 glycosyl transferase, group 2 family protein x x
MG191 mgpA MgPa adhesin x x
MG192 p110 P110 protein x x
MG317 hmw3 HMW3 cytadherence accessory protein x x
MG338 lipoprotein, putative x
MG395 lipoprotein, putative x
MG440 lipoprotein, putative x
Cellular processes
MG278 relA GTP pyrophosphokinase p x
MG335 GTP-binding protein engB, putative x x
DNA metabolism
MG261 polC-2 DNA polymerase III, alpha subunit p x x
MG469 chromosomal replication initiator protein DnaA p x x
MG186 Staphylococcal nuclease homologue, putative x
MG421 uvrA excinuclease ABC, A subunit x x
Energy metabolism
MG118 galE UDP-glucose 4-epimerase p x
MG299 pta phosphate acetyltransferase p x
Hypothetical proteins
MG074 conserved hypothetical protein p
MG241 conserved hypothetical protein p
MG389 conserved hypothetical protein p
MG141.1 conserved hypothetical protein x
MG202 conserved hypothetical protein x
MG296 conserved hypothetical protein x
MG323.1 conserved hypothetical protein x
MG366 conserved hypothetical protein x
MG423 conserved hypothetical protein x x
MG442 GTP-binding conserved hypothetical protein x
Protein fate
MG055 preprotein translocase, SecE subunit p x x
MG208 glycoprotease family protein p
MG270 lipoyltransferase/lipoate-protein ligase, putative p x
MG392 groL chaperonin GroEL p x x x
Protein synthesis
MG059 smpB SsrA-binding protein p x x
MG455 tyrS tyrosyl-tRNA synthetase p x x x
MG182 tRNA pseudouridine synthase A x x
MG209 pseudouridine synthase, RluA family x x
MG295 trmU tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase x
x x x
MG345 ileS isoleucyl-tRNA synthetase x x x x
MG372 thiamine biosynthesis/tRNA modification protein Thil x
MG426 rpmB ribosomal protein L28 x x x x
Purines, pyrimidines, nucleosides, and nucleotides
MG231 nrdE ribonucleoside-diphosphate reductase, alpha chain p x x x
MG049 deoD purine nucleoside phosphorylase x x
MG052 cytidine deaminase x x
Transcription
MG249 rpoD RNA polymerase sigma factor RpoD p x x
Transport and binding proteins
MG045 ABC transporter, spermidine/putrescine binding protein, p x
putative
MG014 ABC transporter, ATP-binding/permease protein x x
MG085 hprK HPr(Ser) kinase/phosphatase x
MG467 ABC transporter, ATP-binding protein x x
MG468 ABC transporter, permease protein x
Unknown function
MG137 UDP-galactopyranose mutase p
MG236 expressed protein of unknown function p
MG263 Cof-like hydrolase p
MG029 DJ-1/Pfpl family protein x
MG130 uncharacterized domain HDIG x
MG132 HIT domain protein x x
MG308 ATP-dependent RNA helicase, DEAD/DEAH box family x x
MG310 hydrolase, alpha/beta fold family x
MG327 hydrolase, alpha/beta fold family x
MG470 CobQ/CobB/MinD/ParA nucleotide binding domain x x
All information is based on the M genitalium genome sequence and
annotation reported herein. Genes are grouped by main biological roles.
The columns for these protein coding genes are as follows:
[0140] M genitalium gene locus
[0141] Gene symbol
[0142] Gene common name [0143] A. M genitalium genes disrupted in the
1999 study are noted with an "X". Genes assumed to be non-essential
because only the M pneumoniae orthologs of the M genitalium gene was
disrupted are noted with a "P". [0144] B. Orthologous genes essential
in Bacillus. subtilis(1). [0145] C. In theoretical minimal 256 gene set
defined by Mushegian and Koonin as orthologous genes present in M
genitalium and H. influenzae(2). [0146] D. In theoretical 206 gene core
of a minimal genome set defined by Gil et al (3).
REFERENCES
[0146] [0147] 1 Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati,
G., Andersen, K. K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S.,
Bessieres, P., et al. (2003) Proc Natl Acad Sci USA 100, 4678-83. [0148]
2. Mushegian, A. R. & Koonin, E. V. (1996) Proc Natl Acad Sci USA 93,
10268-73. [0149] 3. Gil, R., Silva, F. J., Pereto, J. & Moya, A. (2004)
Microbiol Mol Biol Rev 68, 518-37, table of contents.
[0150] From the foregoing description, one skilled in the art can easily
ascertain the essential characteristics of this invention, and without
departing from the spirit and scope thereof, can make changes and
modifications of the invention to adapt it to various usage and
conditions and to utilize the present invention to its fullest extent.
The preceding specific embodiments are to be construed as merely
illustrative, and not limiting of the scope of the invention in any way
whatsoever. The entire disclosure of all applications, patents,
publications (including U.S. provisional application 60/725,295, filed
Oct. 12, 2005) cited above and in the figures, are hereby incorporated in
their entirety by reference.
Sequence CWU
1
1
3 1 30 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 1 gtactcaatg aattaggtgg aagaccgagg
30 2 4 PRT Artificial Sequence Description
of Artificial Sequence Synthetic peptide 2 Asp Glu Ala Asp 1 3 4
PRT Artificial Sequence Description of Artificial Sequence Synthetic
peptide 3 Asp Glu Ala His 1
* * * * *
